Skip to content

Advertisement

BMC Medical Genetics

Open Access
Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

Association of the genetic polymorphisms of the ACE gene and the eNOSgene with lupus nephropathy in northern Chinese population

Contributed equally
BMC Medical Genetics201011:94

https://doi.org/10.1186/1471-2350-11-94

Received: 19 February 2010

Accepted: 14 June 2010

Published: 14 June 2010

Abstract

Background

It has been reported that some single nucleotide polymorphisms (SNPs) of the angiotensin converting enzyme (ACE) gene and the endothelial nitric oxide synthase (eNOS) gene are associated with the development of systemic lupus erythematosus (SLE) and the progression of nephropathy. The aim of this study was to evaluate the possible association between six SNPs (A-5466C, T-3892C, A-240T, C1237T, G2215A and A2350G) of the ACE gene and two SNPs (T-786C and G894T) of the eNOS gene with lupus nephropathy in a northern Chinese population.

Methods

In this study, 225 patients with lupus nephropathy were compared to 232 healthy controls, matched by gender, age and ethnicity. Following the extraction of genomic DNA from the leukocytes in the peripheral blood, the genotypes of the eight selected SNPs were determined by the method of PCR-RFLP; the haplotypes were inferred using PHASE 2.1. The associations between the SNPs and the risk of lupus nephropathy were analyzed using Chi-square test and Logistic regression with SPSS13.0 software.

Results

Statistically significant differences of the allele frequency distribution of three SNPs (A-5466C, A2350G and G894T) were observed between cases and controls (P < 0.05). Among the 53 haplotypes identified, the frequencies of five haplotypes (CTTCGA, ACTTAA, ACATGG, ACACGG and ATTCGA) were significantly different between cases and controls (P < 0.05).

Conclusions

Our study indicated an association between the risk of lupus nephropathy and the sequence variations of both the ACE gene and the eNOS gene, which may play an important role in the pathogenesis of lupus nephropathy in the northern Chinese population. Further studies are warranted to validate our findings.

Background

Systemic lupus erythematosus (SLE) is a complex autoimmune disease involving environmental, genetic and hormonal elements [13]; also it is a multisystem disease with a variable course and a wide range of clinical manifestations[4], such as lupus nephropathy. Renal injury in SLE is one of the most serious complications and its pathogenesis has not yet been completely clarified [1].

It has been extensively documented that genetic factors play an important role in the development and progression of both SLE and lupus nephropathy [57]. Many studies have showed the critical role of the SNPs of the ACE gene and the eNOS gene in the process of the occurrence and progression of SLE [810].

As is widely known that the reninangiotensin system (RAS) is usually involved in the progression of renal diseases [11]. ACE affects various clinical manifestations through the reninangiotensin system by promoting the formation of angiotensin II and inactivating bradykinin [2]. In human, the ACE gene is located on chromosome 17q22-q24 [12] and is expressed in a wide range of tissues, such as lung, vascular endothelium, kidney, heart and testes [9]. Many studies, including one study in a Chinese population [13], have suggested that a 250 bp insertion/deletion (I/D) polymorphism of the ACE gene was associated with SLE and renal injury [1, 13]. Recent studies have reported that several SNPs (A-5466C, T-3892C, A-240T, CJ237T, G2215A and A2350G) of the ACE gene may affect the risk of certain autoimmune diseases such as essential hypertension, left ventricular hypertrophy, IgA nephropathy, diabetic nephropathy and so on [1416]. Therefore, we presume that these SNPs of the ACE gene may also play an important role in the molecular mechanisms of lupus nephropathy.

Nitric oxide (NO) plays an important role in the pathogenesis of SLE, with an elevated level of expression in SLE patients than in healthy controls [17]. NO synthesis is tightly regulated by nitric oxide synthases (NOS), the latter has three isoforms: neuronal (nNOS), inducible (iNOS) and endothelial (eNOS) [18]. The eNOS gene is located on chromosome 7q35-q36 [19], which is an important factor in the process of immunity reaction and the production of NO. It has been reported that two SNPs (T-786C and G894T) of the eNOS gene were associated with the susceptibility of vascular, infectious and autoimmune diseases, such as resistant hypertension, ischemic stroke, essential hypertension, and lacunar infarction [2022]. These SNPs may alter the level of the eNOS gene expression or change the protein product of the gene, and is relevant either to the pathogenesis of SLE or the progression of specific manifestations of diseases such as atherosclerosis and renal complications [23, 24]. Therefore, the eNOS gene is a candidate gene for the analysis of SLE susceptibility [8, 25].

However, the associations between the above mentioned SNPs and the risk of lupus nephropathy have not been evaluated in the Chinese population. The aim of the present study is to investigate the association of these SNPs with lupus nephropathy in a northern Chinese population.

Methods

Subjects

Totally 225 lupus nephropathy patients were recruited from the department of rheumatology, the Second Affiliated Hospital of Harbin Medical University, located in northern China. All patients were classified as lupus nephropathy according to the American College of Rheumatology (ACR) renal criteria [26, 27] or the evidence of the renal biopsy for lupus nephropathy. The methods used for the determination of urinalysis and blood pressure, as well as the diagnostic criteria for serum creatinine and proteinuria were following the World Health Organization (WHO) criteria[28].

The control subjects were enrolled from the individuals who underwent a health examination in the Second Affiliated Hospital of Harbin Medical University. They had no history of rheumatism and immunology diseases, nor any abnormal clinical examination results. Both cases and controls were matched by gender, age and ethnicity. All study participants provided informed consent and donated peripheral blood. This study was approved by the appropriate local authority. The major characteristics of the study subjects were listed in Table 1.
Table 1

Clinical and laboratory characteristics of healthy controls and lupus nephropathy

Characteristics

Control

Lupus nephropathy

n

232

225

Mean age (years) mean ± SD

34.9 ± 9.8

35.2 ± 10.1

Sex ratio (Female: Male)

85/147

81/144

24-hour proteinuria (mg)

-

> 500

persistent hematuria

-

yes

s-Cr(mg/dL)

-

> 1.3

Using the standard method of phenol-chloroform extraction, the DNA samples were prepared from peripheral blood samples anti-coagulated with ACD.

Genotyping of the SNPs of the ACE gene and the eNOSgene

The information of the six SNPs of the ACE gene and two SNPs of the eNOS gene were shown in Table 2, as well as the details of the primers, restriction enzymes and the length of digested fragments. The PCR reactions were performed in a final volume of 25 μl, containing approximately 50 ng genomic DNA, 0.5 μM each primer, 0.2 mM dNTP, 2.0 mM MgCl2, 50 mM KCl, 10 mM Tris HCl (pH 8.4) and 0.2 U Taq DNA Polymerase (TaKaRa). All reactions were performed using a Perkin Elmer 9700. The PCR products were digested and then separated by 2-3% agarose gel electrophoresis.
Table 2

The information of the primers and restriction enzymes

SNP

Location

Primer sequence

Enzyme

Amplification length

The length of digested fragments

  

F-gccatgtcacatgtattatagga

EcoRV

133 bp

24 bp + 109 bp

ACE A-5466C

5'UTR

    
  

R-cgtctttggaaacttgtctgc

   
  

F-atagtgtatatagggcttggtac

PstI

114 bp

90 bp + 24 bp

ACE T-3892C

5'UTR

    
  

R-agaagatatttgcaaagtatgtactg

   
  

F-tgtcactccggaggcgggaggct

XbaI

168 bp

145 bp + 23 bp

ACE A-240T

5'UTR

    
  

R-gagaaagggcctcctctctct

   
  

F-agtgcacacgggtcacgatg

BsmBI

287 bp

95 bp +192 bp

ACE C1237T

exon8

    
  

R-caccaagtagccaaagggcag

   
  

F-cacaccctgaagtacggcac

HaeII

131 bp

109 bp + 22 bp

ACE G2215A

exon14

    
  

R-tcctccagctcctgggcag

   
  

F-ctgacgaatgtgatggccgc

BstUI

122 bp

103 bp + 19 bp

ACE A2350G

exon16

    
  

R-ttgatgagttccacgtatttcg

   
  

F-tggagatgatggtgtacccca

MspI

180 bp

94 bp +46 bp +42 bp

eNOS T-786C

5'UTR

    
  

R-gcctccacccccaccctgtc

   
  

F-aaggcaggagacagtggatgga

Ban II

248 bp

163 bp + 85 bp

eNOS G894T

Exon7

    
  

R- cccagtcaatccctttggtgctca

   

Statistical analysis

After the genotypes of each individual were determined, genotype and allele frequencies were calculated by direct counting. Deviations from Hardy-Weinberg equilibrium (HWE) were tested for all SNPs in control subjects. As these loci of the ACE gene were tightly linked in a LD block, we conducted a haplotype analysis using PHASE 2.1 software. The associations between the allele frequencies and genotype frequencies and lupus nephropathy were analyzed by the Chi-square test and Logistic regression using SPSS13.0 software for Windows. The relative risk of minor alleles compared with major alleles was estimated using odds ratio (OR) and 95% confidence interval (CI), P-values less than 0.05 were considered statistically significant.

Results

Genotype distribution of the ACEgene between patients with lupus nephropathy and controls

All loci were in Hardy-Weinberg equilibrium in controls (p > 0.05). The allele frequencies of the six SNPs (A-5466C, T-3892C, A-240T, C1237T, G2215A and A2350G) of the ACE gene were 0.318 (-5466C), 0.411 (-3892T), 0.402 (-240T), 0.298 (1237C), 0.387 (2215A) and 0.158 (2350G) in cases, and 0.429 (-5466C), 0.457 (-3892T), 0.379 (-240T), 0.295 (1237C), 0.358 (2215A) and 0.244 (2350G) in controls (Table 3).
Table 3

Allele frequencies and genotype frequencies of the SNPs of the ACE gene and the eNOS gene in cases and controls

SNP

Genotype

Control N = 232 (%)

Lupus nephropathy N = 225 (%)

p

OR (95%CI)

 

AA

79(34.05)

108(48.44)

0.002*

0.559(0.384-0.816)

 

AC

107(46.12)

91(40.44)

0.221

1.260(0.870-1.826)

ACEA-5466C

CC

46(19.83)

26(11.56)

0.015*

1.893(1.124-3.186)

 

A allele

265(57.11%)

307(68.22%)

0.001*

0.620(0.473-0.813)

 

C allele

199(42.89%)

143(31.78%)

0.001*

1.612(1.230-2.113)

 

TT

50(21.55)

43(19.11)

0.517

1.163(0.737-1.835)

 

TC

112(48.28)

99(44.00)

0.359

1.188(0.822-1.717)

ACE T-3892C

CC

70(30.17)

83(36.89)

0.128

0.739(0.501-1.092)

 

T allele

212(45.69%)

185(41.11%)

0.163

1.205(0.927-1.566)

 

C allele

252(54.31%)

265(58.89%)

0.163

0.830(0.639-1.078)

 

AA

93(40.09)

79(35.11)

0.272

1.236(0.846-1.807)

 

AT

102(43.97)

111(47.84)

0.250

0.806(0.558-1.164)

ACEA-240T

TT

37(15.95)

35(15.56)

0.908

1.030(0.623-1.704)

 

A allele

273 (62.07%)

269(59.78%)

0.772

0.962(0.739-1.252)

 

T allele

191(37.93%)

181(40.22%)

0.772

1.040(0.799-1.354)

ACE C1237T

CC

24(10.34)

19(8.44)

0.487

1.251(0.665-2.353)

 

CT

89(38.36)

96(42.67)

0.349

0.836(0.575-1.216)

 

TT

119(51.29)

110(48.89)

0.607

1.101(0.763-1.589)

 

C allele

137(29.53%)

134(29.78%)

0.934

0.988(0.744-1.312)

 

T allele

327(70.47%)

316(70.22%)

0.934

1.012(0.762-1.344)

 

GG

98(42.24)

87(38.67)

0.436

1.160(0.798-1.686)

 

AG

102(43.97)

102(45.33)

0.769

0.946(0.654-1.368)

ACEG2215A

AA

32(13.79)

36(16.00)

0.507

0.840(0.501-1.407)

 

G allele

298(64.22%)

276(61.33%)

0.366

1.132(0.865-1.480)

 

A allele

166(35.78%)

174(38.67%)

0.366

0.884(0.676-1.156)

 

AA

138(59.48)

163(72.44)

0.003*

0.558(0.377-0.827)

 

AG

75(32.33)

53(23.56)

0.037*

1.550(1.026-2.343)

ACEA2350G

GG

19 (8.19)

9(4.00)

0.062

2.141(0.947-4.838)

 

A allele

351(75.65%)

379(84.22%)

0.001*

0.582(0.418-0.810)

 

G allele

113(24.35%)

71(15.78%)

0.001*

1.719(1.235-2.391)

 

CC

9(3.88)

11(4.89)

0.598

0.785(0.319-1.933)

 

TC

59(25.43)

57(25.33)

0.981

1.005(0.660-1.532)

eNOS T-786C

TT

164(70.69)

157(69.78)

0.831

1.045(0.699-1.560)

 

T allele

387(83.41%)

371(82.44%)

0.700

1.070(0.758-1.511)

 

C allele

77(16.59%)

79(17.56%)

0.700

0.934(0.662-1.319)

eNOS G894T

GG

179(77.16)

195(86.67)

0.008*

0.520(0.318-0.850)

 

GT

46(19.83)

27(12.00)

0.022*

1.814(1.083-3.037)

 

TT

7(3.02)

3(1.33)

0.215

2.312(0.593-9.019)

 

G allele

404(87.07%)

417(92.67%)

0.005*

0.533(0.341-0.833)

 

T allele

60(12.93%)

33(7.33%)

0.005*

1.877(1.201-2.932)

* p < 0.05

There was a significant difference in the frequency of the -5466C allele between cases and controls (P = 0.001; OR = 1.612, 95%CI = 1.230-2.113). Similarly, the association between the 2350G allele and the risk of lupus nephropathy was significant (P = 0.001; OR = 1.719, 95%CI = 1.235-2.391). However, there was no significant association between the other four SNPs (T-3892C, A-240T, C1237T and G2215A) and lupus nephropathy in this sample (P > 0.05; Table 3).

As shown in Table 3, significant associations was observed between the frequencies of the genotypes of -5466AA/-5466AC+-5466CC and the risk of lupus nephropathy (P = 0.002; OR = 0.559, 95%CI = 0.384-0.816). Such association were also seen between the genotypes of 2350AA/2350AG+2350GG and lupus nephropathy (P = 0.003; OR = 0.558, 95%CI = 0.377-0.827).

Fifty-three haplotypes were identified in these samples and the frequencies of twenty-four haplotypes among them were listed in Table 4. The most common haplotype in lupus nephropathy patients was ACATGA, followed by ACATAA, CCATAA, and CCATGA and so on. Among them, the frequency of the CTTCGA haplotype in lupus nephropathy patients (2.89%) was higher than in healthy controls (0.22%, P = 0.001). The associations between other four haplotypes (ACTTAA, ACATGG, ACACGG and ATTCGA) and lupus nephropathy were also significant (P < 0.05). However, there were no association between the other haplotypes and lupus nephropathy (P > 0.05).
Table 4

Haplotype frequencies of the ACE gene in cases and controls

Haplotype

Control 2N = 464 (%)

Lupus nephropathy 2N = 450 (%)

p

OR (95%CI)

ACATGA

52(11.21)

49(10.89)

0.878

1.033(0.683-1.562)

CCATAA

23(4.96)

30(6.67)

0.269

0.730(0.417-1.277)

ACATAA

21(4.53)

31(6.89)

0.123

0.641(0.362-1.133)

CCATGA

22(4.74)

25(5.56)

0.577

0.846(0.470-1.524)

ATTCGA

12(2.59)

23(5.11)

0.047*

0.493(0.242-1.003)

ACTTGA

22(4.74)

20(4.44)

0.830

1.070(0.576-1.989)

ATATGA

25(5.39)

13(2.89)

0.058

1.914(0.967-3.791)

CCTTAA

32(6.90)

23(5.11)

0.256

1.375(0.792-2.389)

ATTTAA

13(2.80)

21(4.67)

0.136

0.589(0.291-1.191)

ACACGA

13(2.80)

17(3.78)

0.408

0.734(0.352-1.530)

ATATAA

6(1.29)

14(3.11)

0.060

0.408(0.155-1.071)

CCATGG

16(3.45)

11(2.44)

0.370

1.425(0.654-3.106)

ATACGA

11(2.37)

16(3.56)

0.290

0.659(0.302-1.435)

ACTTAA

20(4.31)

6(1.33)

0.007*

3.333(1.326-8.379)

ATTTGA

16(3.45)

10(2.22)

0.265

1.571(0.705-3.501)

CCTTAG

6(1.29)

14(3.11)

0.060

0.408(0.155-1.071)

CTTCGA

1(0.22)

13(2.89)

0.001*

0.073(0.009-0.557)

ACACGG

11(2.37)

3(0.67)

0.036*

3.618(1.003-13.056)

ACTCGA

5(1.08)

9(2.00)

0.256

0.534(0.177-1.605)

ACATGG

11(2.37)

3(0.67)

0.036*

3.618(1.003-13.056)

CCACGA

10(2.16)

4(0.89)

0.119

2.456(0.765-7.888)

CCATAG

6(1.29)

6(1.33)

0.957

0.969(0.310-3.028)

ACACAA

3(0.65)

9(2.00)

0.072

0.319(0.086-1.186)

ACTCAA

7(1.51)

10(2.22)

0.425

0.674(0.254-1.786)

* p < 0.05

Genotype distribution of the eNOSgene between patients with lupus nephropathy and controls

All loci were in Hardy-Weinberg equilibrium in controls (P > 0.05). The allele frequencies were 0.176 (-786C) and 0.073 (894T) in cases, and 0.166 (-786C) and 0.129 (894T) in controls (Table 3). There was a significant difference in the allelic frequency of the 894T allele between cases and controls (P = 0.005; OR = 1.877, 95%CI = 1.201-2.932), while the association was not significant between the genotype frequency of the -786C and lupus nephropathy (P = 0.700; OR = 0.934, 95%CI = 0.662-1.319). As shown in Table 3, the association between the 894GG/894GT+894TT genotypes and lupus nephropathy was statistically significant (P = 0.008; OR = 0.520, 95%CI = 0.318-0.850).

Since both the ACE gene and the eNOS gene were associated with the risk of lupus nephropathy, we evaluated the interaction of the two genes, using SNPs that were significantly associated with the disease. Neither the interaction of ACE A-5466C and eNOS G-894T nor the interaction of ACE A-2350G and eNOS G-894T were significant, P values were 0.093 and 0.950, respectively.

Discussion

Lupus nephropathy happens at a high frequency in patients with SLE, and it has been suggested to be related to abnormal regulation of the complex system consisting of the RAS and the NO system, both regulating vascular tone and inflammation. These two systems may have a profound effect in the pathogenesis and progression of SLE and the development of lupus nephropathy. Multiple genetic and environmental factors may be implicated in the evolution of lupus nephropathy. Different genetic variants contribute to the SLE phenotype from populations of different genetic backgrounds are becoming increasingly apparent [29]. In recent years, complete genome scans have tried to search for SLE susceptibility loci [30], two candidate genes identified are the ACE gene and the eNOS gene [31], which are inter-related [32]. ACE is a key component of RAS and it converts angiotensin I to II [33]. It inhibits the progression pace of the majority of chronic nephropathies [34]. eNOS is an important isoform of NOS, which plays an important role in autoimmune diseases [23, 35]. Polymorphisms of the eNOS gene are relevant to the pathogenesis of certain diseases correlate with SLE [36]. As a family-based association analysis has already shown an association between ACE G-261T and SLE in a Chinese population [37], we did not test this locus in our study. Six SNPs (A-5466C, T-3892C, A-240T, C1237T, G2215A and A2350G) of the ACE gene and two SNPs (T-786C and G894T) of the eNOS gene have been selected since they may affect the susceptibility to some autoimmune diseases [36].

In this study, significant differences in genotype distribution of two SNPs (A-5466C and A2350G) of the ACE gene were observed between cases and controls. The differences are similar to previous reports [38, 39], and are strong predictors of plasma ACE levels [40, 41]. No association was observed between the allelic frequency distribution of other SNPs and lupus nephropathy, although they have been studied extensively in high prevalence of renal disorders among hypertensive [42, 43]. Our results suggested that ACE -5466C and ACE 2350G allele play a significant protect role in the pathology of renal disease, and ACE -5466A allele in homozygote individuals and ACE 2350A allele in dominant genetic model were risk allele for lupus nephropathy.

The association between some of the haplotypes and lupus nephropathy were shown to be significant. Among them, the haplotypes ACTTAA, ACACGG and ACATGG play protective role in the renal injury in SLE, while haplotypes ATTCGA and CTTCGA were risk factors. To the best of our knowledge, this is the first study focusing on the SNPs of ACE gene and eNOS gene in Chinese population.

NO is an important biological molecule, which has a critical role in many biological systems. It has been identified as a potent mediator of immune and inflammatory response. Studies have shown that the levels of NO are significantly elevated in SLE patients in comparison with controls. A correlation has been found between serum NO and SLE disease activity[17]. For example, the T-786C and its interaction with G894T have impact on the basal nitric oxide activity of renal circulation, essential hypertension and diabetic nephropathy in multi-ethnical population [44, 45]. In this study, the association between the variations of the eNOS gene (G894T) and the presence of nephropathy in SLE was significant, with the eNOS 894T allele play a significant protect role in the pathology of renal injury in SLE, and eNOS 894G allele in dominant genetic model were susceptibility gene for lupus nephropathy. However, no such association was found with the eNOS T-786C.

The above inconsistency could be due in part to the heterogeneity of the ACE gene and the eNOS gene among different ethnic groups [21, 46], since it is often the case that the same SNP has different roles in different populations. Another reason may be the unclear stratification of the patients with the lupus nephropathy, such as first attack or recurrence and the age of onset and so on. Furthermore, environmental factors for cases and controls were not available in this study, which limited the analysis of the interaction between genetic factors and environmental factors, and further the estimation of adjusted ORs. Finally, the sample size for this study was relatively small due to the limited time of the collection of cases, the result of this study need validation.

Although some limitations do exist in this study, ours is an innovative study with some promising findings that contribute to the evaluation of genetic risk factors for lupus nephropathy. The clues provided in this study call for further research, other association studies, as well as functional studies are warranted to prove the association from multiple aspects. For the analysis of the association between these SNPs and the progression of this disease. Further studies, with larger sample sizes, are necessary to determine the contribution of these alleles to lupus nephropathy progression.

Conclusions

Our study shows that two SNPs (-5466C and 2350G) of the ACE gene and the one SNP (G894T) of the eNOS gene were associated with the susceptibility of lupus nephropathy. Five haplotypes (CTTCGA, ACTTAA, ACATGG, ACACGG and ATTCGA) were found to contribute to the risk of lupus nephropathy, suggesting an important role they played in the pathology of lupus nephropathy.

Notes

Declarations

Acknowledgements

We sincerely acknowledge the numerous donors for making this work possible. We thank the corresponding people of Harbin Medical University, Heilongjiang University of Chinese Medicine and Chinese medical hospital of Weihai city, who helped us selflessly during the process of the study.

Authors’ Affiliations

(1)
Department of Rheumatology, the Second Affiliated Hospital of Harbin Medical University, Harbin, P.R. China
(2)
Department of Pathology, Harbin Medical University, Harbin, P.R. China
(3)
Chinese medical hospital of Weihai city, Weihai, P.R. China
(4)
Department of Pathology, Mudanjiang Medical University, Mudanjiang, P.R. China
(5)
Heilongjiang University of Chinese Medicine, Harbin, P.R. China
(6)
Department of laboratory Diagnosis, the First Affiliated Hospital of Harbin Medical University, Harbin, P.R. China
(7)
Department of Rheumatology, the First affiliated hospital of Baotou Medical College, Baotou, P.R. China
(8)
Laboratory of Medical Genetics, Harbin Medical University, Harbin, P.R. China

References

  1. Sprovieri SR, Sens YA: Polymorphisms of the renin-angiotensin system genes in Brazilian patients with lupus nephropathy. Lupus. 2005, 14: 356-362. 10.1191/0961203305lu2093oa.View ArticlePubMedGoogle Scholar
  2. Uhm WS, Lee HS, Chung YH, Kim TH, Bae SC, Joo KB, Kim TY, Yoo DH: Angiotensin-converting enzyme gene polymorphism and vascular manifestations in Korean patients with SLE. Lupus. 2002, 11: 227-233. 10.1191/0961203302lu174oa.View ArticlePubMedGoogle Scholar
  3. Tan FK, Arnett FC: The genetics of lupus. Curr Opin Rheumatol. 1998, 10: 399-408. 10.1097/00002281-199809000-00002.View ArticlePubMedGoogle Scholar
  4. Gudmundsson S, Steinsson K: Systemic lupus erythematosus in Iceland 1975 through 1984. A nationwide epidemiological study in an unselected population. J Rheumatol. 1990, 17: 1162-1167.PubMedGoogle Scholar
  5. Schelling JR, Zarif L, Sehgal A, Iyengar S, Sedor JR: Genetic susceptibility to end-stage renal disease. Curr Opin Nephrol Hypertens. 1999, 8: 465-472. 10.1097/00041552-199907000-00011.View ArticlePubMedGoogle Scholar
  6. Freedman BI, Wilson CH, Spray BJ, Tuttle AB, Olorenshaw IM, Kammer GM: Familial clustering of end-stage renal disease in blacks with lupus nephritis. Am J Kidney Dis. 1997, 29: 729-732. 10.1016/S0272-6386(97)90126-8.View ArticlePubMedGoogle Scholar
  7. Harley JB, Moser KL, Gaffney PM, Behrens TW: The genetics of human systemic lupus erythematosus. Curr Opin Immunol. 1998, 10: 690-696. 10.1016/S0952-7915(98)80090-3.View ArticlePubMedGoogle Scholar
  8. Parsa A, Peden E, Lum RF, Seligman VA, Olson JL, Li H, Seldin MF, Criswell LA: Association of angiotensin-converting enzyme polymorphisms with systemic lupus erythematosus and nephritis: analysis of 644 SLE families. Genes Immun. 2002, S42-46. 10.1038/sj.gene.6363907. 3 Suppl 1Google Scholar
  9. Kaufman KM, Kelly J, Gray-McGuire C, Asundi N, Yu H, Reid J, Baird T, Hutchings D, Bruner G, Scofield RH, et al: Linkage analysis of angiotensin-converting enzyme (ACE) insertion/deletion polymorphism and systemic lupus erythematosus. Mol Cell Endocrinol. 2001, 177: 81-85. 10.1016/S0303-7207(01)00424-5.View ArticlePubMedGoogle Scholar
  10. Serrano NC, Paez C, Correa PA, Anaya JM: Endothelial nitric oxide synthase gene polymorphism is associated with systemic lupus erythematosus. J Rheumatol. 2004, 31: 2163-2168.PubMedGoogle Scholar
  11. Kim S, Iwao H: Molecular and cellular mechanisms of angiotensin II-mediated cardiovascular and renal diseases. Pharmacol Rev. 2000, 52: 11-34.PubMedGoogle Scholar
  12. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM: Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet. 1992, 1: 72-75. 10.1038/ng0492-72.View ArticlePubMedGoogle Scholar
  13. Huang J, Yang Y, Li L: Study of relationship between ACE gene I/D polymorphism and renal predisposition in SLE. J Clinical Internal Medcine. 1999, 16: 205-206.Google Scholar
  14. Schena FP, D'Altri C, Cerullo G, Manno C, Gesualdo L: ACE gene polymorphism and IgA nephropathy: an ethnically homogeneous study and a meta-analysis. Kidney Int. 2001, 60: 732-740. 10.1046/j.1523-1755.2001.060002732.x.View ArticlePubMedGoogle Scholar
  15. Gutierrez C, Vendrell J, Pastor R, Llor C, Aguilar C, Broch M, Richart C: Angiotensin I-converting enzyme and angiotensinogen gene polymorphisms in non-insulin-dependent diabetes mellitus. Lack of relationship with diabetic nephropathy and retinopathy in a Caucasian Mediterranean population. Metabolism. 1997, 46: 976-980. 10.1016/S0026-0495(97)90090-1.View ArticlePubMedGoogle Scholar
  16. Narita I, Goto S, Saito N, Song J, Omori K, Kondo D, Sakatsume M, Gejyo F: Renoprotective efficacy of renin-angiotensin inhibitors in IgA nephropathy is influenced by ACE A2350G polymorphism. J Med Genet. 2003, 40: e130-10.1136/jmg.40.12.e130.View ArticlePubMedPubMed CentralGoogle Scholar
  17. Wanchu A, Khullar M, Deodhar SD, Bambery P, Sud A: Nitric oxide synthesis is increased in patients with systemic lupus erythematosus. Rheumatol Int. 1998, 18: 41-43. 10.1007/s002960050055.View ArticlePubMedGoogle Scholar
  18. Lapointe J, Roy M, St-Pierre I, Kimmins S, Gauvreau D, MacLaren LA, Bilodeau JF: Hormonal and spatial regulation of nitric oxide synthases (NOS) (neuronal NOS, inducible NOS, and endothelial NOS) in the oviducts. Endocrinology. 2006, 147: 5600-5610. 10.1210/en.2005-1548.View ArticlePubMedGoogle Scholar
  19. Marsden PA, Heng HH, Scherer SW, Stewart RJ, Hall AV, Shi XM, Tsui LC, Schappert KT: Structure and chromosomal localization of the human constitutive endothelial nitric oxide synthase gene. J Biol Chem. 1993, 268: 17478-17488.PubMedGoogle Scholar
  20. Cruz-Gonzalez I, Corral E, Sanchez-Ledesma M, Sanchez-Rodriguez A, Martin-Luengo C, Gonzalez-Sarmiento R: Association between -T786C NOS3 polymorphism and resistant hypertension: a prospective cohort study. BMC Cardiovasc Disord. 2009, 9: 35-10.1186/1471-2261-9-35.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Xin Y, Song X, Xue H, Liu Z, Wang X, Wang H, Sun K, Bai Y, Liu J, Hui R: A common variant of the eNOS gene (E298D) is an independent risk factor for left ventricular hypertrophy in human essential hypertension. Clin Sci (Lond). 2009, 117: 67-73. 10.1042/CS20080476.View ArticleGoogle Scholar
  22. Yemisci M, Sinici I, Ozkara HA, Hayran M, Ay H, Celtikci B, Onder E, Buyukserbetci G, Kaya EB, Tokgozoglu L, et al: Protective role of 27 bp repeat polymorphism in intron 4 of eNOS gene in lacunar infarction. Free Radic Res. 2009, 43: 272-279. 10.1080/10715760802691489.View ArticlePubMedGoogle Scholar
  23. Wang XL, Wang J: Endothelial nitric oxide synthase gene sequence variations and vascular disease. Mol Genet Metab. 2000, 70: 241-251. 10.1006/mgme.2000.3033.View ArticlePubMedGoogle Scholar
  24. Akcay A, Sezer S, Ozdemir FN, Arat Z, Atac FB, Verdi H, Colak T, Haberal M: Association of the genetic polymorphisms of the renin-angiotensin system and endothelial nitric oxide synthase with chronic renal transplant dysfunction. Transplantation. 2004, 78: 892-898. 10.1097/01.TP.0000134972.81306.B1.View ArticlePubMedGoogle Scholar
  25. Hingorani AD: Polymorphisms in endothelial nitric oxide synthase and atherogenesis: John French Lecture 2000. Atherosclerosis. 2001, 154: 521-527. 10.1016/S0021-9150(00)00699-7.View ArticlePubMedGoogle Scholar
  26. Tan EM, Cohen AS, Fries JF, Masi AT, McShane DJ, Rothfield NF, Schaller JG, Talal N, Winchester RJ: The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 1982, 25: 1271-1277. 10.1002/art.1780251101.View ArticlePubMedGoogle Scholar
  27. Hochberg MC: Updating the American College of Rheumatology revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 1997, 40: 1725-10.1002/art.1780400928.View ArticlePubMedGoogle Scholar
  28. Ferrario F, Rastaldi MP: Histopathological atlas of renal diseases: anti-glomerular basement membrane antibody disease. J Nephrol. 2005, 18: 351-353.PubMedGoogle Scholar
  29. Croker JA, Kimberly RP: Genetics of susceptibility and severity in systemic lupus erythematosus. Curr Opin Rheumatol. 2005, 17: 529-537. 10.1097/01.bor.0000169360.15701.27.View ArticlePubMedGoogle Scholar
  30. Manson JJ, Isenberg DA: The pathogenesis of systemic lupus erythematosus. Neth J Med. 2003, 61: 343-346.PubMedGoogle Scholar
  31. Gaffney PM, Ortmann WA, Selby SA, Shark KB, Ockenden TC, Rohlf KE, Walgrave NL, Boyum WP, Malmgren ML, Miller ME, et al: Genome screening in human systemic lupus erythematosus: results from a second Minnesota cohort and combined analyses of 187 sib-pair families. Am J Hum Genet. 2000, 66: 547-556. 10.1086/302767.View ArticlePubMedPubMed CentralGoogle Scholar
  32. Conen D, Glynn RJ, Buring JE, Ridker PM, Zee RY: Association of renin-angiotensin and endothelial nitric oxide synthase gene polymorphisms with blood pressure progression and incident hypertension: prospective cohort study. J Hypertens. 2008, 26: 1780-1786. 10.1097/HJH.0b013e3283077eef.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Bernstein KE, Martin BM, Edwards AS, Bernstein EA: Mouse angiotensin-converting enzyme is a protein composed of two homologous domains. J Biol Chem. 1989, 264: 11945-11951.PubMedGoogle Scholar
  34. Campbell R, Sangalli F, Perticucci E, Aros C, Viscarra C, Perna A, Remuzzi A, Bertocchi F, Fagiani L, Remuzzi G, et al: Effects of combined ACE inhibitor and angiotensin II antagonist treatment in human chronic nephropathies. Kidney Int. 2003, 63: 1094-1103. 10.1046/j.1523-1755.2003.00832.x.View ArticlePubMedGoogle Scholar
  35. Bredt DS, Snyder SH: Nitric oxide: a physiologic messenger molecule. Annu Rev Biochem. 1994, 63: 175-195. 10.1146/annurev.bi.63.070194.001135.View ArticlePubMedGoogle Scholar
  36. Miyahara K, Kawamoto T, Sase K, Yui Y, Toda K, Yang LX, Hattori R, Aoyama T, Yamamoto Y, Doi Y, et al: Cloning and structural characterization of the human endothelial nitric-oxide-synthase gene. Eur JBiochem. 1994, 223: 719-726. 10.1111/j.1432-1033.1994.tb19045.x.View ArticleGoogle Scholar
  37. Xu J, Wang Y, Pan F, Stankovich J, Ye D, Lian L, Zhang K, Ding C: Association of ACE gene polymorphism with genetic susceptibility to systemic lupus erythematosus in a Chinese population: a family-based association study. J Rheumatol. 2007, 34: 2408-2411.PubMedGoogle Scholar
  38. Ng DP, Placha G, Choo S, Chia KS, Warram JH, Krolewski AS: A disease haplotype for advanced nephropathy in type 2 diabetes at the ACE locus. Diabetes. 2006, 55: 2660-2663. 10.2337/db06-0496.View ArticlePubMedGoogle Scholar
  39. Barbalic M, Skaric-Juric T, Cambien F, Barbaux S, Poirier O, Turek S, Vrhovski-Hebrang D, Cubrilo-Turek M, Rudan I, Rudan P, et al: Gene polymorphisms of the renin-angiotensin system and early development of hypertension. Am JHypertens. 2006, 19: 837-842. 10.1016/j.amjhyper.2006.01.004.View ArticleGoogle Scholar
  40. Tiret L, Rigat B, Visvikis S, Breda C, Corvol P, Cambien F, Soubrier F: Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet. 1992, 51: 197-205.PubMedPubMed CentralGoogle Scholar
  41. Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F: An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest. 1990, 86: 1343-1346. 10.1172/JCI114844.View ArticlePubMedPubMed CentralGoogle Scholar
  42. Redon J, Chaves FJ, Liao Y, Pascual JM, Rovira E, Armengod ME, Cooper RS: Influence of the I/D polymorphism of the angiotensin-converting enzyme gene on the outcome of microalbuminuria in essential hypertension. Hypertension. 2000, 35: 490-495.View ArticlePubMedGoogle Scholar
  43. Baghai TC, Binder EB, Schule C, Salyakina D, Eser D, Lucae S, Zwanzger P, Haberger C, Zill P, Ising M, et al: Polymorphisms in the angiotensin-converting enzyme gene are associated with unipolar depression, ACE activity and hypercortisolism. Mol Psychiatry. 2006, 11: 1003-1015. 10.1038/sj.mp.4001884.View ArticlePubMedGoogle Scholar
  44. Rossi GP, Cesari M, Zanchetta M, Colonna S, Maiolino G, Pedon L, Cavallin M, Maiolino P, Pessina AC: The T-786C endothelial nitric oxide synthase genotype is a novel risk factor for coronary artery disease in Caucasian patients of the GENICA study. J Am Coll Cardiol. 2003, 41: 930-937. 10.1016/S0735-1097(02)03012-7.View ArticlePubMedGoogle Scholar
  45. Tang W, Yang Y, Wang B, Xiao C: Association between a G894T polymorphism of eNOS gene and essential hypertension in Hani and Yi minority groups of China. Arch Med Res. 2008, 39: 222-225. 10.1016/j.arcmed.2007.08.002.View ArticlePubMedGoogle Scholar
  46. Zhao Q, Su SY, Chen SF, Li B, Gu DF: Association study of the endothelial nitric oxide synthase gene polymorphisms with essential hypertension in northern Han Chinese. Chin Med J (Engl). 2006, 119: 1065-1071.Google Scholar
  47. Pre-publication history

    1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2350/11/94/prepub

Copyright

© Li et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement