Association of the genetic polymorphisms of the ACE gene and the eNOSgene with lupus nephropathy in northern Chinese population

Table 2 The information of the primers and restriction enzymes

SNP	Location	Primer sequence	Enzyme	Amplification length	The length of digested fragments
		F-gccatgtcacatgtattatagga	EcoRV	133 bp	24 bp + 109 bp
ACE A-5466C	5'UTR
		R-cgtctttggaaacttgtctgc
		F-atagtgtatatagggcttggtac	PstI	114 bp	90 bp + 24 bp
ACE T-3892C	5'UTR
		R-agaagatatttgcaaagtatgtactg
		F-tgtcactccggaggcgggaggct	XbaI	168 bp	145 bp + 23 bp
ACE A-240T	5'UTR
		R-gagaaagggcctcctctctct
		F-agtgcacacgggtcacgatg	BsmBI	287 bp	95 bp +192 bp
ACE C1237T	exon8
		R-caccaagtagccaaagggcag
		F-cacaccctgaagtacggcac	HaeII	131 bp	109 bp + 22 bp
ACE G2215A	exon14
		R-tcctccagctcctgggcag
		F-ctgacgaatgtgatggccgc	BstUI	122 bp	103 bp + 19 bp
ACE A2350G	exon16
		R-ttgatgagttccacgtatttcg
		F-tggagatgatggtgtacccca	MspI	180 bp	94 bp +46 bp +42 bp
eNOS T-786C	5'UTR
		R-gcctccacccccaccctgtc
		F-aaggcaggagacagtggatgga	Ban II	248 bp	163 bp + 85 bp
eNOS G894T	Exon7
		R- cccagtcaatccctttggtgctca

ISSN: 1471-2350