Open Access
Open Peer Review

This article has Open Peer Review reports available.

How does Open Peer Review work?

Sequencing of DC-SIGN promoter indicates an association between promoter variation and risk of nasopharyngeal carcinoma in cantonese

BMC Medical Genetics201011:161

https://doi.org/10.1186/1471-2350-11-161

Received: 20 June 2010

Accepted: 11 November 2010

Published: 11 November 2010

Abstract

Background

The dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin (DC-SIGN) is an important pathogen recognition receptor of the innate immune system. DC-SIGN promoter variants play important role in the susceptibility to various infectious diseases. Nasopharyngeal carcinoma (NPC) is a malignancy that is common in southern China and whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown. The aim of this study is to ascertain the potential involvement of DC-SIGN promoter single nucleotide polymorphisms (SNPs) in NPC susceptibility.

Methods

We conducted a case control study based on Cantonese population including 444 NPC patients and 464 controls matched on age and sex. The 1041 bp of DC-SIGN promoter region was directly sequenced for all samples. Sequence alignment and SNP search were inspected using DNAStar analysis programs and haplotype frequencies were estimated in Haploview V 4.0. The associations between the SNPs and the risk of NPC were analyzed using chi-square test and non-conditional logistic regression analysis with SPSS 13.0 software.

Results

A total of six variants were observed in the DC-SIGN promoter region and DC-SIGN -139 GG and -939 AA were significantly associated with NPC risk with adjusted Odds Ratios (ORs) of 2.10 (95% confidence interval [CI] = 1.23-3.59; P = 0.006) and 2.52 (1.29-4.93; P = 0.007) respectively and subjects carrying the risk allele DC-SIGN -871 G had 1.47-fold (95% CI = 1.14-1.90) increased risks of developing NPC (P = 0.003). Haplotype analysis revealed that h1 'AAAG' was significantly associated with protection against NPC (OR = 0.69; P = 0.0002) and the association was still significant when using 1000 permutation test runs (P = 0.001).

Conclusions

Our study indicated that DC-SIGN promoter variants appear to be involved in the susceptibility to NPC and the detailed mechanism of this effect need further studies.

Background

Nasopharyngeal carcinoma (NPC) is rare in most populations around the world but common in China and Southeast Asia, where the incidence can reach 20 to 50 per 100,000 individuals [15]. Epstein-Barr virus (EBV) is considered a major risk factor for NPC, and there is a dose-response relationship between EBV antibodies and NPC risk [6, 7]. EBV is present in over 90% of the world population [8], most often as a form of in vivo latency in healthy carriers with low copies of episomal virus maintained in resting memory B cells [911].

DC-SIGN (Dendritic cell-specific intercellular adhesion molecule 3 grabbing non-integrin), encoded by CD209 on chromosome 19p13.3, is a C-type lectin that is expressed on subsets of dendritic cells (DCs) and alveolar macrophages [1215], and functions both as a cell adhesion receptor and as a pathogen recognition receptor [16]. Acting as a pathogen uptake receptor, DC-SIGN could mediate interactions with a plethora of pathogens [17] including bacteria such as Helicobacter pylori [18]; viruses such as HIV-1 [19], Ebola [20, 21], Cytomegalovirus [22], Hepatitis-C virus [23, 24], Dengue virus [20, 21, 25], and SARS-coV [26], and parasites such as Leishmania pifanoi [27]. Several studies have recently reported on the role of DC-SIGN promoter variants in the susceptibility to or pathogenesis of various infectious diseases, such as dengue fever [25, 28], tuberculosis [13, 14, 29, 30], Acquired Immune Deficiency Syndrome (AIDS) [19, 3133], celiac disease [34]. Sakuntabhai et al. [25] reported that the G allele of the variant DC-SIGN -336 was associated with strong protection against dengue fever [35]. In addition, several previous reports suggested that variants in the DC-SIGN promoter conferred protection against tuberculosis [29, 30]. However, whether DC-SIGN promoter variants have effects on susceptibility to NPC is still unknown and so far no study has reported on the variants in the DC-SIGN promoter in Cantonese population.

Therefore, we explored the relationship between DC-SIGN promoter polymorphisms and susceptibility to NPC by determining DC-SIGN promoter sequence variation in a case-control study in Cantonese.

Methods

Study subjects

All subjects were unrelated Cantonese population in Guangdong Province, China. Cases were recruited consecutively from December 2005 to October 2006 with pathologically confirmed diagnosis of NPC at the Sun Yat-Sen University Cancer Center (SYSUCC), Guangzhou, China. Total 500 NPC patients were collected and 444 were Cantonese origin living in Southern China. Population controls were cancer-free individuals, randomly selected from individuals who attend annual community-based physical examinations during the same time period. The selection criteria for control subjects included no individual history of cancer, all of them were Cantonese, and matched to NPC cases by age (± 5 years), sex and the time period for blood sample collection. Total 464 controls were involved. All study subjects had signed informed consent agreements before epidemiological data and blood samples were collected by trained SYSUCC staff interviewers.

For both cases and controls, venous blood specimens totalling 5-10 ml were collected from subjects and genomic DNA was then extracted from the lymphocytes using the QIAamp DNA Blood Midi Kit (Qiagen, German) following the manufacturer's protocol. These procedures were reviewed and approved by the Human Ethics Approval Committee of SYSUCC.

Genotyping of DC-SIGN promoter variants

A region approximately 1,041 bp upstream of the ATG start codon that includes the promoter region was amplified using the following primers: 5- 'GCAGTCTTGGTTCCTTGGAG -3' for forward primer 1 and 5- 'ACTTGCAGTGCCTCCTCAGT -3' for reverse primer 1; 5'-TGCTGCTGTCCTCATTTTTG-3' for forward primer 2 and 5'-AGCATACAGAAACCCCGTTG-3' for reverse primer 2. Primer 1 delimits the promoter region between nt -602 and 28 [GenBank: NC_000019.9)] and amplifies a 630 bp fragment. Primer 2 delimits the promoter region between nt -404 and nt -1041 and amplifies a 638 bp fragment. Polymerase chain reaction (PCR) amplification was performed in a volume of 20 μL as follows: 15.85 μL ddH2O, 2.0 μL 10 × reaction buffer (with Mg2+), 0.5 μL 4 × dNTP (10 mmol L-1), 0.2 μL of each primer (20 μM), 1.25 U Taq DNA polymerase, and 1 μL genomic DNA (20 ng). Touchdown PCR was performed in the model 9700 GeneAmp PCR system (Applied Biosystems, Foster City, CA) with the following conditions: one initial denaturation of 95°C for 5 minutes, and then 5 cycles of 94°C for 30 seconds, 61°C for 30 seconds (-0.5°C every cycle), and 72°C for 45 seconds; then 32 cycles of 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 45 seconds, followed by one elongation step at 72°C for 10 minutes. The amplified products were analysed by 1.5% agarose gel electrophoresis followed by ethidium bromide staining. PCR amplification was performed using the same conditions for primer 1 and primer 2 as described above.

PCR products were recovered, and further purified. Sequencing reactions were performed using PCR primers and all nucleotide sequences were obtained using the 3730 automated sequencer (Applied Biosystems). Sequence alignment and SNP search were inspected using DNAStar analysis programs (DNAStar, Madison, WI, USA) using the nucleic acid sequences from Genebank at National Center for Biotechnology Information (NCBI) as the prototype sequence [GenBank: NC_000019.9].

Statistical analysis

To test the different promoter polymorphisms of DC-SIGN gene for a possible distortion in genotypic and allelic frequencies between cases and controls, a chi-square test or Fisher's exact test was used to compare the genotypic and allelic distribution between cases and controls. In addition, to control confounding factors, unconditional logistic regression analysis was conducted to compare the genotype frequencies between cases and controls by adjusting for age, sex, the level of educational. The analyses were performed in SPSS software for Windows, version 13.0 (SPSS). For power calculation, the QUANTO program (Version 1.2) was used.

Haplotype frequencies were estimated using the accelerated expectation maximisation algorithm implemented in Haploview V 4.0 [36]. Haplotype frequencies occurring at <5% were excluded from the analysis. Association testing for the haplotypes was performed using the chi-square test. ORs were calculated with 95% CI. Significant associations were defined as P < 0.05 and all statistical tests were two-tailed.

Results

This study included a total of 444 NPC patients and 464 control subjects. The characteristics of study subjects are summarised in Table 1. The mean age (± standard deviation) of the patients was 41.7 ± 9.6 y and 61.0% of the cases were male. For controls, the age was 41.3 ± 10.6 y and 60.1% of subjects were male. There was no statistically significant difference between cases and controls with respect to the frequency distributions of age and the sex distribution was unbiased (all P-values > 0.05). There was significant association between the level of education and NPC susceptibility. In current study, 21.7% of the case patients versus 8.0% of control subjects were illiterate or had an education of primary school (P < 0.001).
Table 1

Demographic characteristics and socio-economic status of the study population

Variables

Case (n = 444)

Control (n = 464)

P-value*

Gender (%)

   

   Male

271 (61.0)

279 (60.1)

0.78

   Female

173 (39.0)

185 (39.9)

 

Age(%), mean ± SD (y)

41.7 ± 9.6

41.3 ± 10.6

 

   ≤30

49 (11.0)

61(13.1)

0.71

   31-40

163 (36.7)

158 (34.1)

 

   41-50

162 (36.5)

163 (35.2)

 

   51-60

51 (11.5)

60 (12.9)

 

   61~

19 (4.3)

22 (4.8)

 

Level of education

   

   Illiteracy or primary school

94 (21.7)

37 (8.0)

<0.001

   High school

268 (61.8)

255 (55.1)

 

   University or above

72 (16.6)

171 (36.9)

 

*P- values were calculated using the chi-square test.

Direct sequencing of the promoter region of DC-SIGN revealed the occurrence of six variants: -939 G/A, -871 A/G, -336 A/G, -190 A/G, -139 A/G and -116 G/T. Table 2 presents detailed information on these six variants. The minor allele frequencies (MAFs) of all SNPs evaluated in the DC-SIGN promoter were >0.05 except for -190 A/G (MAF = 0.003) and -116 G/T (MAF = 0.006), and all loci fit Hardy-Weinberg equilibrium expectations (P-values > 0.05).
Table 2

The minor allele frequencies and Hardy-Weinberg equilibrium tests of 6 variants in DC-SIGN gene

Polymorphism

NCBI rs number

Position

Genotype

Gene region

MAF §

PH-W

% Geno -typed

Code

Name

       

1

DC-SIGN -116

--

7718513

G/T

Promoter

0.006

1.00

100.0

2

DC-SIGN -139

rs2287886

7718536

A/G

Promoter

0.275

0.64

100.0

3

DC-SIGN -190

--

7718587

A/G

Promoter

0.003

1.00

100.0

4

DC-SIGN -336

rs4804803

7718733

A/G

Promoter

0.085

0.96

100.0

5

DC-SIGN -871

rs735239

7719268

A/G

5'flanking

0.154

0.58

100.0

6

DC-SIGN -939

rs735240

7719336

G/A

5'flanking

0.222

0.71

100.0

The chromosome position listed here is taken from the NCBI database dbSNP build 130.

First allele is major allele, the second is minor allele.

§ MAF denotes Minor Allele Frequency.

PH-W represents the P value of Hardy-Weinberg equilibrium tests.

Table 3 presents the genotypic and allelic frequencies of these six variants among Cantonese population. For DC-SIGN -139 A/G, subjects carrying mutant genotype -139 AG, which means a SNP -139 A/G in heterozygous alleles and -139 GG, which means a SNP -139 A/G in both G alleles, had 1.42-fold (95% CI = 1.07-1.86) and 1.99-fold (95% CI = 1.20-3.30) increased risks of developing NPC, respectively, when compared with those carrying wild genotype -139 AA. After adjusting for age, sex and the level of education, genotype -139 AG and -139 GG had 1.41-fold (95% CI = 1.05-1.88) and 2.10-fold (95% CI = 1.23-3.59) increased risks of developing NPC, respectively, when compared with those carrying wild genotype -139 AA (P trend = 0.005). Furthermore, subjects carrying the risk allele -139 G had 1.42-fold (95% CI = 1.15-1.74) increased risks of developing NPC when compared with those carrying allele -139 A (P = 0.001). In addition, subjects possessing mutant genotype -871 AG and GG had higher risks of developing NPC (OR = 1.43; 95% CI = 1.06-1.93 and OR = 2.34; 95% CI = 0.99-5.54, respectively) when compared with those carrying wild genotype -871 AA and those carrying the risk allele -871 G had 1.47-fold (95% CI = 1.14-1.90) increased risks of developing NPC when compared with those carrying allele -871 A (P = 0.003). After adjusting for age, sex and the level of education, there was no significant association between -871 GG genotype and NPC susceptibility (P = 0.14), which maybe mainly due to the small sample size. However, the association between -871 AG genotype and NPC susceptibility was still significant (P = 0.03). For DC-SIGN -939 G/A, subjects carrying mutant genotype -939 AA had a 2.56-fold increased risk of developing NPC (OR = 2.56; 95% CI = 1.36-4.83; P = 0.003) compared to those carrying wild-type genotype -939 GG and the association is still significant after adjusting for age, sex and the level of education (OR = 2.52; 95% CI = 1.29-4.93; P = 0.007). Furthermore, the association between the risk allele -939 A and NPC susceptibility was statistically significant (OR = 1.43; 95% CI = 1.15-1.79; P = 0.002). However, for the other three SNPs, there were no significant differences between cases and controls. For power calculation, the powers for all of the three significant SNPs, DC-SIGN-139, -871 and -939, were 0.92, 0.87 and 0.90, respectively.
Table 3

Association between DC-SIG N promoter variants and NPC

SNP

Genotype

Case

Control

UnadjustedOR (95% CI)*

Unadjusted P-value*

Adjusted OR (95% CI) #

Adjusted P-value #

DC-SIGN -116

GG

440

457

ref

 

ref

 
 

GT

4

7

0.59(0.17-2.04)

0.40

0.57 (0.16-2.01)

0.38

 

TT

0

0

--

--

--

--

Allele

G

884

921

ref

   
 

T

4

7

0.60(0.17-2.04)

0.40

--

--

DC-SIGN -139

AA

212

268

ref

 

ref

 
 

AG

188

168

1.42 (1.07-1.86)

0.01

1.41 (1.05-1.88)

0.02

 

GG

44

28

1.99 (1.20-3.30)

0.007

2.10 (1.23-3.59)

0.006

       

P trend = 0.005

Allele

A

612

704

ref

   
 

G

276

224

1.42 (1.15-1.74)

0.001

--

--

DC-SIGN -190

AA

441

462

ref

 

ref

 
 

AG

3

2

1.57 (0.26-9.45)

0.68

1.57 (0.24-10.36)

0.64

 

GG

0

0

--

--

--

--

Allele

A

885

926

ref

   
 

G

3

2

1.57 (0.26-9.42)

0.68

--

--

DC-SIGN -336

AA

365

396

ref

 

ref

 
 

AG

77

63

1.33 (0.92-1.91)

0.13

1.43 (0.98-2.09)

0.07

 

GG

2

5

0.43 (0.08-2.25)

0.45

0.57 (0.11-3.07)

0.51

       

P trend = 0.14

Allele

A

807

855

ref

   
 

G

81

73

1.18 (0.85-1.64)

0.34

--

--

DC-SIGN -871

AA

301

352

ref

 

ref

 
 

AG

127

104

1.43(1.06-1.93)

0.02

1.44 (1.05-1.98)

0.03

 

GG

16

8

2.34 (0.99-5.54)

0.05

1.97 (0.80-4.88)

0.14

       

P trend = 0.04

Allele

A

729

808

ref

   
 

G

159

120

1.47 (1.14-1.90)

0.003

--

--

DC-SIGN -939

GG

251

301

ref

 

ref

 
 

AG

161

148

1.31 (0.99-1.72)

0.06

1.28 (0.95-1.71)

0.11

 

AA

32

15

2.56 (1.36-4.83)

0.003

2.52 (1.29-4.93)

0.007

       

P trend = 0.01

Allele

G

663

750

ref

   
 

A

225

178

1.43 (1.15-1.79)

0.002

--

--

* Odds ratios and P- values were calculated using the chi-square test.

# Odds ratios and P-Values were calculated by adjusting for age, sex, educational level.

Moreover, we performed the analyses at the haplotype level and found that there was significant linkage disequilibrium among DC-SIGN -139 A/G, -336 A/G, -871 A/G and -939 G/A, and a block was constructed by these four SNPs (Figure 1). Table 4 shows the results of haplotype analysis and reveals that h1 'AAAG', representing wild-type for all four common SNPs (-139 A, -336 A, -871 A and -939 G) and accounting for 68.4% of all haplotypes, was associated with protection against NPC (OR = 0.69; 95% CI = 0.57- 0.84; P = 2.0 × 10-4). Further, using 1000 permutation test runs, we also detected a significant association (P = 0.001) between this haplotype and NPC phenotype. In addition, h2 'GAGA', which accounts for 14.1% of all haplotypes, was associated with NPC risk (OR = 1.34; 95% CI = 1.03-1.75; P = 0.03). However, when using using 1000 permutation test runs, there was no significant association between h2 'GAGA' and NPC phenotype (P = 0.23).
Figure 1

LD block structure around DC-SIGN promoter region. Haplotype block structure, as depicted by Haploview, is shown. The three-color scheme (white to red) represents the increasing strength of LD. Values for D' is shown, those boxes with D' = 1 are shaded in bright red and blank. Cells with D' < 1 are shades of pink or red with 100 × D' indicated.

Table 4

Association between DC-SIG N Haplotypes and NPC risk

Hap

Block

HaploFreq

Case Ratios

Control Ratios

Chisq

OR (95% CI)

P-value*

EMP

h1

AAAG

0.684

0.643

0.723

13.6

0.69 (0.57-0.84)

2.0 × 10-4

0.001

h2

GAGA

0.141

0.159

0.124

4.70

1.34 (1.03-1.75)

0.03

0.23

h3

GGAG

0.084

0.091

0.078

1.06

1.19 (0.85-1.66)

0.30

0.92

The code of each haplotype.

The frequency of each haplotype.

*P- values were calculated using the chi-square test.

EMP = 1,000 permutation test P value.

Discussion

This report on the distribution of genetic polymorphisms in the DC-SIGN promoter in the Cantonese population revealed that DC-SIGN -139 GG and -939 AA were significantly associated with increased risk of NPC and the risk allele DC-SIGN -871 G was significantly associated with NPC susceptibility (Table 3). Haplotype analysis revealed that h1 'AAAG', which contains all four wild-type SNPs (-139 A, -336 A, -871 A and -939 G), was associated with a significantly decreased risk of NPC and h2 'GAGA' was significantly associated with the NPC phenotype (Table 4). Moreover, we found two new variants in Cantonese population, -116 G/T and -190 A/G, although the MAFs for both were low (0.6% and 0.3%, respectively).

In current study, the MAFs of four common SNPs (-139 A/G, -336 A/G, -871 A/G and -939 G/A) in the promoter region of DC-SIGN in Cantonese population were similar to that in 45 unrelated Han Chinese in Beijing, China (HCB) http://www.ncbi.nlm.nih.gov/projects/SNP/snp. In addition, Kashima et al. [37] found that the allelic frequency of DC-SIGN -332 A was 10.7% by sequencing 28 Asians; however, this SNP was neither detected by Barreiro et al. in Asians [30] nor by Koizumi et al. in Japanese individuals [31]. Equally, this SNP is not detected in individuals of Cantonese in current study, which indicates that DC-SIGN -332 A is not widespread in most Asians. Two other SNPs in the promoter region, DC-SIGN -745 G/T and -201 G/T, were not present in current cohort, though they were observed exclusively in the Zimbabwean population [38]. The allelic distribution of DC-SIGN genes differs widely in populations from different ethnic groups, presumably the result of selective pressure exerted by prevalent pathogens in these geographically distinct regions. NPC is rare in most populations around the world but common in China and Southeast Asia and this could be reflected in SNP frequencies. DC-SIGN, a protein expressed on the surface of DCs, has recently received considerable attention in research on AIDS [33], dengue [25, 35], tuberculosis [29, 30] and Ulcerative Colitis [39]. Previous studies have indicated that DC-SIGN -336 G is associated with protection against dengue disease in Thailand population [25] and tuberculosis disease in sub-Saharan Africa individuals [29]. It may mainly due to the location of the DC-SIGN -336 SNP 214 bp upstream of the major transcription site, affecting a Sp1-like binding site and further modulating DC-SIGN transcriptional activity [25]. However, Barreiro and colleagues [30] found that -336 A and -871 G variants conferred protection against tuberculosis in Eurasian populations. Meriem Ben-Ali et al. [40] found no association between DC-SIGN promoter variation and susceptibility to tuberculosis in Tunisian patients. These contrasting results may be due to significant differences in the distribution of DC-SIGN alleles in different ethnic populations [38]. Different population genetic backgrounds as well as differences in linkage disequilibrium (LD) patterns can be at the basis of the conflicting results. In current study, there was no observable association between DC-SIGN -336 SNP and NPC susceptibility in the Cantonese population.

The mechanism of involvement of mutant DC-SIGN -139 and 939 in the pathogenesis of NPC remains unknown. Previous studies have already demonstrated a higher frequency of allele DC-SIGN -139 A in individuals not infected with HIV compared with infected patients [32]. In another study, allele -139 G was found to be associated with the rapid progression of AIDS in a population of Japanese haemophiliacs [31]. In current study, we found that the frequencies of DC-SIGN -139 GG and -939 AA were significantly higher in NPC patients compared with healthy controls. One potential mechanism for this effect may involve differential inducible expression of DC-SIGN on blood DCs as a result of these two polymorphisms, but this remains to be demonstrated. DC-SIGN -139 is located close to one of the binding sites of the transcription factor AP-1 in the promoter region of DC-SIGN, and we could speculate that the substitution of one nucleotide close to this site may change the level of expression of DC-SIGN and further contribute to the progression of NPC. As for DC-SIGN -939, it is yet to be determined whether this variant will affect the expression of DC-SIGN.

EBV is an important etiological agent of NPC and establishes persistent infections by employing multiple strategies to evade host immune responses. Consistent with the critical function of DCs in anti-viral immunity, myriad viruses are known to infect different subsets of DCs and to affect their differentiation, survival, and migration and/or T cell stimulatory capacity [4144]. However, no studies have been performed so far to determine whether DC-SIGN is the EBV receptor. EBV has been observed to infect DC-SIGN positive cells such as immature DCs [45], monocytes [4648] and some macrophages [4951]. Furthermore, Li et al. [45]showed that EBV infection inhibited DC development from monocyte precursors, and further showed that immature DCs that become resistant to EBV-induced apoptosis still support virus entry [50]. Guerreiro-Cacais AO et al reported that EBV-infected macrophages could facilitate dissemination of EBV within the oral mucosal epithelium [50]. Recently, DC-SIGN could serve as putative receptor for secretory IgA (SIgA) on immature DCs by binding to high mannose glycoprotein on SIgA protein has been reported [52]. Sixbey JW et al have demonstrated that EBV-SIgA complex promoted EBV infection of epithelial cells through secretory component-mediated IgA transport [53]. We hypothesize that DC-SIGN expressed on immature DCs may recognize EBV-SIgA complex though binding to SIgA and thus promote EBV infection of immature DCs. This link DC-SIGN to EBV infection of immature DCs was need further confirmed and the study is on the way in our Lab.

We would like to point out that the sample size of the current study was not large enough and these results need to be validated in larger samples. Despite limitations, the current study represents the first comprehensive genetic association study examining the relationship between DC-SIGN promoter genetic variants and NPC risk in a case-control study and supplying genetic data of DC-SIGN promoter polymorphism in Cantonese population.

Conclusions

Our study shows that the mutant genotypes -139 GG and -939 AA detected in the promoter region of the DC-SIGN gene were involved in NPC susceptibility, and further studies are necessary to demonstrate the role of DC-SIGN promoter polymorphisms in the function of DC-SIGN as well as their effect on EBV infection.

Declarations

Acknowledgements

This work was supported by National Natural Science Foundation of China (No. 30630068 and 30972762), National Science and Technology Support Program of China (2006BAI02A11), National Major Basic Research Program of China (863: 2006AA02A404; 973: 2006CB910104; 973: 2011CB504300) and Program for Changjiang Scholars and Innovative Research Team in University (IRT0663).

Authors’ Affiliations

(1)
State Key Laboratory of Oncology in South China
(2)
Department of Experimental Research, Sun Yat-sen University Cancer Center

References

  1. Feng BJ, Huang W, Shugart YY, Lee MK, Zhang F, Xia JC, Wang HY, Huang TB, Jian SW, Huang P, et al: Genome-wide scan for familial nasopharyngeal carcinoma reveals evidence of linkage to chromosome 4. Nat Genet. 2002, 31 (4): 395-399.PubMedGoogle Scholar
  2. Ou SH, Zell JA, Ziogas A, Anton-Culver H: Epidemiology of nasopharyngeal carcinoma in the United States: improved survival of Chinese patients within the keratinizing squamous cell carcinoma histology. Ann Oncol. 2007, 18 (1): 29-35. 10.1093/annonc/mdl320.View ArticlePubMedGoogle Scholar
  3. Ng WT, Choi CW, Lee MC, Chan SH, Yau TK, Lee AW: Familial nasopharyngeal carcinoma in Hong Kong: epidemiology and implication in screening. Fam Cancer. 2009, 8 (2): 103-108. 10.1007/s10689-008-9213-9.View ArticlePubMedGoogle Scholar
  4. Takeshita H, Furukawa M, Fujieda S, Shoujaku H, Ookura T, Sakaguchi M, Ito H, Mineta H, Harada T, Matsuura H, et al: Epidemiological research into nasopharyngeal carcinoma in the Chubu region of Japan. Auris Nasus Larynx. 1999, 26 (3): 277-286. 10.1016/S0385-8146(98)00080-7.View ArticlePubMedGoogle Scholar
  5. Busson P, Ooka T, Corbex M: Nasopharyngeal carcinomas and Epstein-Barr virus: from epidemiology and detection to therapy. Med Sci (Paris). 2004, 20 (4): 453-457.View ArticleGoogle Scholar
  6. Pattle SB, Farrell PJ: The role of Epstein-Barr virus in cancer. Expert Opin Biol Ther. 2006, 6 (11): 1193-1205. 10.1517/14712598.6.11.1193.View ArticlePubMedGoogle Scholar
  7. Raab-Traub N: Epstein-Barr virus in the pathogenesis of NPC. Semin Cancer Biol. 2002, 12 (6): 431-441. 10.1016/S1044579X0200086X.View ArticlePubMedGoogle Scholar
  8. Rickinson ABKE: Epstein-Barr virus. Field's virology. Edited by: Knipe DM, Howley PM. 2001, Philadelphia (Pennsylvania): Lippincott,Williams & Wilkins, 2575-2627. 4Google Scholar
  9. Pepperl S, Benninger-Doring G, Modrow S, Wolf H, Jilg W: Immediate-early transactivator Rta of Epstein-Barr virus (EBV) shows multiple epitopes recognized by EBV-specific cytotoxic T lymphocytes. J Virol. 1998, 72 (11): 8644-8649.PubMedPubMed CentralGoogle Scholar
  10. Cohen JI: Epstein-Barr virus infection. N Engl J Med. 2000, 343 (7): 481-492. 10.1056/NEJM200008173430707.View ArticlePubMedGoogle Scholar
  11. Feng P, Ren EC, Liu D, Chan SH, Hu H: Expression of Epstein-Barr virus lytic gene BRLF1 in nasopharyngeal carcinoma: potential use in diagnosis. J Gen Virol. 2000, 81 (Pt 10): 2417-2423.View ArticlePubMedGoogle Scholar
  12. Soilleux EJ, Barten R, Trowsdale J: DC-SIGN; a related gene, DC-SIGNR; and CD23 form a cluster on 19p13. J Immunol. 2000, 165 (6): 2937-2942.View ArticlePubMedGoogle Scholar
  13. Tailleux L, Pham-Thi N, Bergeron-Lafaurie A, Herrmann JL, Charles P, Schwartz O, Scheinmann P, Lagrange PH, de Blic J, Tazi A, et al: DC-SIGN induction in alveolar macrophages defines privileged target host cells for mycobacteria in patients with tuberculosis. PLoS Med. 2005, 2 (12): e381-10.1371/journal.pmed.0020381.View ArticlePubMedPubMed CentralGoogle Scholar
  14. Tailleux L, Schwartz O, Herrmann JL, Pivert E, Jackson M, Amara A, Legres L, Dreher D, Nicod LP, Gluckman JC, et al: DC-SIGN is the major Mycobacterium tuberculosis receptor on human dendritic cells. J Exp Med. 2003, 197 (1): 121-127. 10.1084/jem.20021468.View ArticlePubMedPubMed CentralGoogle Scholar
  15. Geijtenbeek TB, Torensma R, van Vliet SJ, van Duijnhoven GC, Adema GJ, van Kooyk Y, Figdor CG: Identification of DC-SIGN, a novel dendritic cell-specific ICAM-3 receptor that supports primary immune responses. Cell. 2000, 100 (5): 575-585. 10.1016/S0092-8674(00)80693-5.View ArticlePubMedGoogle Scholar
  16. Soilleux EJ, Morris LS, Leslie G, Chehimi J, Luo Q, Levroney E, Trowsdale J, Montaner LJ, Doms RW, Weissman D, et al: Constitutive and induced expression of DC-SIGN on dendritic cell and macrophage subpopulations in situ and in vitro. J Leukoc Biol. 2002, 71 (3): 445-457.PubMedGoogle Scholar
  17. Geijtenbeek TB, van Vliet SJ, Engering A, t Hart BA, van Kooyk Y: Self- and nonself-recognition by C-type lectins on dendritic cells. Annu Rev Immunol. 2004, 22: 33-54. 10.1146/annurev.immunol.22.012703.104558.View ArticlePubMedGoogle Scholar
  18. Bergman MP, Engering A, Smits HH, van Vliet SJ, van Bodegraven AA, Wirth HP, Kapsenberg ML, Vandenbroucke-Grauls CM, van Kooyk Y, Appelmelk BJ: Helicobacter pylori modulates the T helper cell 1/T helper cell 2 balance through phase-variable interaction between lipopolysaccharide and DC-SIGN. J Exp Med. 2004, 200 (8): 979-990. 10.1084/jem.20041061.View ArticlePubMedPubMed CentralGoogle Scholar
  19. Geijtenbeek TB, Kwon DS, Torensma R, van Vliet SJ, van Duijnhoven GC, Middel J, Cornelissen IL, Nottet HS, KewalRamani VN, Littman DR, et al: DC-SIGN, a dendritic cell-specific HIV-1-binding protein that enhances trans-infection of T cells. Cell. 2000, 100 (5): 587-597. 10.1016/S0092-8674(00)80694-7.View ArticlePubMedGoogle Scholar
  20. Alvarez CP, Lasala F, Carrillo J, Muniz O, Corbi AL, Delgado R: C-type lectins DC-SIGN and L-SIGN mediate cellular entry by Ebola virus in cis and in trans. J Virol. 2002, 76 (13): 6841-6844. 10.1128/JVI.76.13.6841-6844.2002.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Simmons G, Reeves JD, Grogan CC, Vandenberghe LH, Baribaud F, Whitbeck JC, Burke E, Buchmeier MJ, Soilleux EJ, Riley JL, et al: DC-SIGN and DC-SIGNR bind ebola glycoproteins and enhance infection of macrophages and endothelial cells. Virology. 2003, 305 (1): 115-123. 10.1006/viro.2002.1730.View ArticlePubMedGoogle Scholar
  22. Halary F, Amara A, Lortat-Jacob H, Messerle M, Delaunay T, Houles C, Fieschi F, Arenzana-Seisdedos F, Moreau JF, Dechanet-Merville J: Human cytomegalovirus binding to DC-SIGN is required for dendritic cell infection and target cell trans-infection. Immunity. 2002, 17 (5): 653-664. 10.1016/S1074-7613(02)00447-8.View ArticlePubMedGoogle Scholar
  23. Lozach PY, Amara A, Bartosch B, Virelizier JL, Arenzana-Seisdedos F, Cosset FL, Altmeyer R: C-type lectins L-SIGN and DC-SIGN capture and transmit infectious hepatitis C virus pseudotype particles. J Biol Chem. 2004, 279 (31): 32035-32045. 10.1074/jbc.M402296200.View ArticlePubMedGoogle Scholar
  24. Pohlmann S, Zhang J, Baribaud F, Chen Z, Leslie GJ, Lin G, Granelli-Piperno A, Doms RW, Rice CM, McKeating JA: Hepatitis C virus glycoproteins interact with DC-SIGN and DC-SIGNR. J Virol. 2003, 77 (7): 4070-4080. 10.1128/JVI.77.7.4070-4080.2003.View ArticlePubMedPubMed CentralGoogle Scholar
  25. Despres P, Sakuntabhai A, Julier C: [A variant in the CD209 (DC-SIGN) promoter is associated with severity of dengue disease]. Med Sci (Paris). 2005, 21 (11): 905-906.View ArticleGoogle Scholar
  26. Marzi A, Gramberg T, Simmons G, Moller P, Rennekamp AJ, Krumbiegel M, Geier M, Eisemann J, Turza N, Saunier B, et al: DC-SIGN and DC-SIGNR interact with the glycoprotein of Marburg virus and the S protein of severe acute respiratory syndrome coronavirus. J Virol. 2004, 78 (21): 12090-12095. 10.1128/JVI.78.21.12090-12095.2004.View ArticlePubMedPubMed CentralGoogle Scholar
  27. Colmenares M, Puig-Kroger A, Pello OM, Corbi AL, Rivas L: Dendritic cell (DC)-specific intercellular adhesion molecule 3 (ICAM-3)-grabbing nonintegrin (DC-SIGN, CD209), a C-type surface lectin in human DCs, is a receptor for Leishmania amastigotes. J Biol Chem. 2002, 277 (39): 36766-36769. 10.1074/jbc.M205270200.View ArticlePubMedGoogle Scholar
  28. Tassaneetrithep B, Burgess TH, Granelli-Piperno A, Trumpfheller C, Finke J, Sun W, Eller MA, Pattanapanyasat K, Sarasombath S, Birx DL, et al: DC-SIGN (CD209) mediates dengue virus infection of human dendritic cells. J Exp Med. 2003, 197 (7): 823-829. 10.1084/jem.20021840.View ArticlePubMedPubMed CentralGoogle Scholar
  29. Vannberg FO, Chapman SJ, Khor CC, Tosh K, Floyd S, Jackson-Sillah D, Crampin A, Sichali L, Bah B, Gustafson P, et al: CD209 genetic polymorphism and tuberculosis disease. PLoS One. 2008, 3 (1): e1388-10.1371/journal.pone.0001388.View ArticlePubMedPubMed CentralGoogle Scholar
  30. Barreiro LB, Neyrolles O, Babb CL, Tailleux L, Quach H, McElreavey K, Helden PD, Hoal EG, Gicquel B, Quintana-Murci L: Promoter variation in the DC-SIGN-encoding gene CD209 is associated with tuberculosis. PLoS Med. 2006, 3 (2): e20-10.1371/journal.pmed.0030020.View ArticlePubMedPubMed CentralGoogle Scholar
  31. Koizumi Y, Kageyama S, Fujiyama Y, Miyashita M, Lwembe R, Ogino K, Shioda T, Ichimura H: RANTES -28G delays and DC-SIGN - 139C enhances AIDS progression in HIV type 1-infected Japanese hemophiliacs. AIDS Res Hum Retroviruses. 2007, 23 (5): 713-719. 10.1089/aid.2006.0225.View ArticlePubMedGoogle Scholar
  32. Martin MP, Lederman MM, Hutcheson HB, Goedert JJ, Nelson GW, van Kooyk Y, Detels R, Buchbinder S, Hoots K, Vlahov D, et al: Association of DC-SIGN promoter polymorphism with increased risk for parenteral, but not mucosal, acquisition of human immunodeficiency virus type 1 infection. J Virol. 2004, 78 (24): 14053-14056. 10.1128/JVI.78.24.14053-14056.2004.View ArticlePubMedPubMed CentralGoogle Scholar
  33. Geijtenbeek TB, van Kooyk Y: DC-SIGN: a novel HIV receptor on DCs that mediates HIV-1 transmission. Curr Top Microbiol Immunol. 2003, 276: 31-54.PubMedGoogle Scholar
  34. Nunez C, Rueda B, Martinez A, Maluenda C, Polanco I, Lopez-Nevot MA, Ortega E, Sierra E, Gomez de la Concha E, Urcelay E, et al: A functional variant in the CD209 promoter is associated with DQ2-negative celiac disease in the Spanish population. World J Gastroenterol. 2006, 12 (27): 4397-4400.View ArticlePubMedPubMed CentralGoogle Scholar
  35. Sakuntabhai A, Turbpaiboon C, Casademont I, Chuansumrit A, Lowhnoo T, Kajaste-Rudnitski A, Kalayanarooj SM, Tangnararatchakit K, Tangthawornchaikul N, Vasanawathana S, et al: A variant in the CD209 promoter is associated with severity of dengue disease. Nat Genet. 2005, 37 (5): 507-513. 10.1038/ng1550.View ArticlePubMedGoogle Scholar
  36. Barrett JC, Fry B, Maller J, Daly MJ: Haploview: analysis and visualization of LD and haplotype maps. Bioinformatics. 2005, 21 (2): 263-265. 10.1093/bioinformatics/bth457.View ArticlePubMedGoogle Scholar
  37. Kashima S, Rodrigues ES, Azevedo R, da Cruz Castelli E, Mendes-Junior CT, Yoshioka FK, da Silva IT, Takayanagui OM, Covas DT: DC-SIGN (CD209) gene promoter polymorphisms in a Brazilian population and their association with human T-cell lymphotropic virus type 1 infection. J Gen Virol. 2009, 90 (Pt 4): 927-934. 10.1099/vir.0.008367-0.View ArticlePubMedPubMed CentralGoogle Scholar
  38. Boily-Larouche G, Zijenah LS, Mbizvo M, Ward BJ, Roger M: DC-SIGN and DC-SIGNR genetic diversity among different ethnic populations: potential implications for pathogen recognition and disease susceptibility. Hum Immunol. 2007, 68 (6): 523-530. 10.1016/j.humimm.2007.02.002.View ArticlePubMedGoogle Scholar
  39. Nunez C, Oliver J, Mendoza JL, Gomez-Garcia M, Taxonera C, Gomez LM, Lopez-Nevot MA, de la Concha EG, Urcelay E, Martinez A, et al: CD209 in inflammatory bowel disease: a case-control study in the Spanish population. BMC Med Genet. 2007, 8: 75-10.1186/1471-2350-8-75.View ArticlePubMedPubMed CentralGoogle Scholar
  40. Ben-Ali M, Barreiro LB, Chabbou A, Haltiti R, Braham E, Neyrolles O, Dellagi K, Gicquel B, Quintana-Murci L, Barbouche MR: Promoter and neck region length variation of DC-SIGN is not associated with susceptibility to tuberculosis in Tunisian patients. Hum Immunol. 2007, 68 (11): 908-912. 10.1016/j.humimm.2007.09.003.View ArticlePubMedGoogle Scholar
  41. Becker Y: Immunological and regulatory functions of uninfected and virus infected immature and mature subtypes of dendritic cells--a review. Virus Genes. 2003, 26 (2): 119-130. 10.1023/A:1023427228024.View ArticlePubMedGoogle Scholar
  42. Kobelt D, Lechmann M, Steinkasserer A: The interaction between dendritic cells and herpes simplex virus-1. Curr Top Microbiol Immunol. 2003, 276: 145-161.PubMedGoogle Scholar
  43. Schneider-Schaulies S, Klagge IM, ter Meulen V: Dendritic cells and measles virus infection. Curr Top Microbiol Immunol. 2003, 276: 77-101.PubMedGoogle Scholar
  44. Sevilla N, Kunz S, McGavern D, Oldstone MB: Infection of dendritic cells by lymphocytic choriomeningitis virus. Curr Top Microbiol Immunol. 2003, 276: 125-144.PubMedGoogle Scholar
  45. Li L, Liu D, Hutt-Fletcher L, Morgan A, Masucci MG, Levitsky V: Epstein-Barr virus inhibits the development of dendritic cells by promoting apoptosis of their monocyte precursors in the presence of granulocyte macrophage-colony-stimulating factor and interleukin-4. Blood. 2002, 99 (10): 3725-3734. 10.1182/blood.V99.10.3725.View ArticlePubMedGoogle Scholar
  46. Savard M, Belanger C, Tardif M, Gourde P, Flamand L, Gosselin J: Infection of primary human monocytes by Epstein-Barr virus. J Virol. 2000, 74 (6): 2612-2619. 10.1128/JVI.74.6.2612-2619.2000.View ArticlePubMedPubMed CentralGoogle Scholar
  47. Masy E, Adriaenssens E, Montpellier C, Crepieux P, Mougel A, Quatannens B, Goormachtigh G, Faumont N, Meggetto F, Auriault C, et al: Human monocytic cell lines transformed in vitro by Epstein-Barr virus display a type II latency and LMP-1-dependent proliferation. J Virol. 2002, 76 (13): 6460-6472. 10.1128/JVI.76.13.6460-6472.2002.View ArticlePubMedPubMed CentralGoogle Scholar
  48. Schlitt A, Blankenberg S, Weise K, Gartner BC, Mehrer T, Peetz D, Meyer J, Darius H, Rupprecht HJ: Herpesvirus DNA (Epstein-Barr virus, herpes simplex virus, cytomegalovirus) in circulating monocytes of patients with coronary artery disease. Acta Cardiol. 2005, 60 (6): 605-610. 10.2143/AC.60.6.2004932.View ArticlePubMedGoogle Scholar
  49. Ochoa MT, Loncaric A, Krutzik SR, Becker TC, Modlin RL: "Dermal dendritic cells" comprise two distinct populations: CD1+ dendritic cells and CD209+ macrophages. J Invest Dermatol. 2008, 128 (9): 2225-2231. 10.1038/jid.2008.56.View ArticlePubMedPubMed CentralGoogle Scholar
  50. Guerreiro-Cacais AO, Li L, Donati D, Bejarano MT, Morgan A, Masucci MG, Hutt-Fletcher L, Levitsky V: Capacity of Epstein-Barr virus to infect monocytes and inhibit their development into dendritic cells is affected by the cell type supporting virus replication. J Gen Virol. 2004, 85 (Pt 10): 2767-2778. 10.1099/vir.0.80140-0.View ArticlePubMedGoogle Scholar
  51. Shimakage M, Kimura M, Yanoma S, Ibe M, Yokota S, Tsujino G, Kozuka T, Dezawa T, Tamura S, Ohshima A, et al: Expression of latent and replicative-infection genes of Epstein-Barr virus in macrophage. Arch Virol. 1999, 144 (1): 157-166. 10.1007/s007050050492.View ArticlePubMedGoogle Scholar
  52. Baumann J, Park CG, Mantis NJ: Recognition of secretory IgA by DC-SIGN: implications for immune surveillance in the intestine. Immunol Lett. 2010, 131 (1): 59-66. 10.1016/j.imlet.2010.03.005.View ArticlePubMedPubMed CentralGoogle Scholar
  53. Sixbey JW, Yao QY: Immunoglobulin A-induced shift of Epstein-Barr virus tissue tropism. Science. 1992, 255 (5051): 1578-1580. 10.1126/science.1312750.View ArticlePubMedGoogle Scholar
  54. Pre-publication history

    1. The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2350/11/161/prepub

Copyright

© Xu et al; licensee BioMed Central Ltd. 2010

This article is published under license to BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Advertisement