The affected individual was a 15-month-old boy who passed away due to aspiration pneumonia. He was born to consanguineous parents, who were first-degree cousins. The child presented at the age of 3 months with lethargy, protracted vomiting, hypotonia, and decreased level of consciousness and was admitted to the pediatric intensive care unit (PICU). Arterial blood gas analysis revealed a pH of 7.02 (normal range: 7.35–7.45), pCO2 of 17.6 (normal range: 35–45) mm Hg and [HCO3] of 5.3 (normal range: 20–28) mmol/L. The acute attack had been managed with hydration and administration of IV bicarbonate in order to correct the acidosis. Other routine laboratory investigations revealed no abnormalities with a hemoglobin of 11.3 (normal range for 3–6-month-old infants: 9.5–14.1) g/dL, total white blood cell count of 6700/mm3 (normal range for 3–6-month-old infant: 6000–17,500/mm3), blood urea nitrogen of 15 (normal range: 5–20) mg/dL, creatinine of 0.5 (normal range: 0.2–0.5) mg/dL, sodium of 135 (normal range: 135–145) mEq/L, potassium of 4.6 (normal range: 3.5–5) mEq/L, and blood sugar of 92 (normal range: 65–99) mg/dL. Liver function enzyme levels were also within normal range. Analysis of the CSF revealed no abnormalities. Evaluation for metabolic disease using tandem mass spectrometry revealed elevated levels of propionylcarnitine (10.3 μmol/L, normal range < 2.5 μmol/L) and increased propionylcarnitine/acylcarnitine ratio (0.53, normal range < 0.13). Methylmalonic acid level was not determined. The patient was subsequently discharged with L-carnitine, vitamin B12 and chronic alkaline therapy.
In subsequent evaluations the patient had an improvement in the overall condition. However, growth parameters were not within normal range. Weight being 6 kg and length being 66 cm were both lower than one percentile for age. The patient also failed to reach developmental milestones. At the age of 9 months, he had head lag and was not able to sit alone, could not transfer objects hand to hand and did not say two-syllable words. Furthermore, he had two other episodes of acute attacks, which had led to hospital admission. At the age of 15 months, he presented with tachypnea, fever, cough, and decreased level of consciousness. Chest x-ray was in favor of aspiration pneumonia. Intravenous antibiotics were administered and alkaline therapy was started. However, the patient showed no clinical response to the treatment.
To determine the causative genetic mutation in the family, an unbiased next generation DNA sequencing which covered the entire coding exons (whole exome sequencing, WES) was carried out. Peripheral blood was obtained from parents and was used to isolate genomic DNA. WES was done utilizing next generation sequencing on an Illumina NextSeq500 (Illumina, USA). The results were subsequently analyzed with BWA aligner [19], GATK [20] and ANNOVAR [21]. To identify common probably pathogenic mutations in the couple, carrier screening was performed on annotated data. Filtering was accomplished based on local (sample size: 1183 unrelated individuals) and other available population databases (such as ExAC browser, gnomAD and Kaviar VARiants).
WES was performed with a mean target coverage of 100×. Results revealed a novel heterozygous missense mutation in MUT gene (c.1055A > G, p.Q352R) in both male and female partners. Homozygous mutations in this gene are compatible with MMA and since MMA has an autosomal-recessive pattern of inheritance, this finding suggests that the child had probably had MMA by inheriting both mutated alleles.
To confirm the presence and the pattern of inheritance of the novel identified mutation, peripheral blood samples from the couple and their parents and siblings were taken; DNA was extracted and used for Sanger sequencing. QIAamp DNA Blood Mini kit (Cat No./ID: 51104, Germany) was used for genomic DNA extraction. The following primers were used to amplify exon five of MUT gene as well as its flanking intronic sequences to look for the mutation—Forward: 5′ TCAGCACTACAGGGAAGCTAG 3′ and Reverse: 5′ GACCTAACGTTACTATTTTAGGTTGT 3′.
The amplified DNA was sequenced from both directions using Sanger Sequencing kit (ABI BigDye Terminator Cycle Sequencing Kit, Applied Biosystems®, USA) according to the company protocol. Sanger sequencing confirmed the presence of mutation in heterozygous form in both parents. The parents’ siblings were either heterozygous carriers or homozygous for the wild type allele (Fig. 1). This mutation is a variant of uncertain significance and has not previously been reported. However, bioinformatics software programs such as Polyphen, SIFT, LRT, Mutation Taster, FATHMM, Radial SVM, and Mutation Assessor software have predicted that this variant will be damaging. Moreover, comparative amino acids alignment using multiple sequence alignment revealed that this amino acid is highly conserved among different species (Fig. 2).
Ovarian stimulation was performed using the antagonist protocol. The couple underwent intra-cytoplasmic sperm insemination. Among four retrieved oocytes, three were fertilized and produced three 8-cells embryos on day three. One blastomere from each cleavage stage embryo was isolated and transferred into a sterile 0.2-mL PCR tube containing 5 μL of PBS and kept at − 80 °C in this condition until testing. DNA amplification across the exon 5 of the MUT gene of each of the blastomeres was done using whole-genome amplification (WGA) reaction.
Whole-genome amplification reaction was done by REPLI-g Single Cell kit (QIAGEN). Briefly, samples were mixed with 3 μL of denaturation buffer and incubated at 65 °C for 10 min, followed by inactivation by adding 3 μL of stop solution. Then, master mix containing REPLI-g sc DNA polymerase was added to the denatured DNAs. Finally, the mixture was incubated at 30 °C for 8 h followed by heat inactivation at 65 °C for 3 min. The products were kept at 4 °C until PCR amplification. DNA amplification of one of the embryos failed. DNA amplification was successful with the other two blastomeres. There was no amplification in the medium blank controls ran simultaneously.
PCR was performed on the products for the amplification of the exon 5 of the MUT gene. Sanger sequencing was then performed on the PCR products to determine the MUT genotype of the embryos using 3130xl Genetic Analyzer (Applied Biosystems). Among the two successfully amplified blastomeres, one was diagnosed as homozygous for the wild-type allele and the other was homozygous for the mutated allele (Fig. 3). The unaffected embryo was then transferred. Single embryo transfer (SET) resulted in a successful implantation and clinical pregnancy confirmed by detection of gestational sac and fetal heart at 4–5 weeks after embryo transfer by transvaginal ultrasonography. The embryo was confirmed as unaffected (homozygous wild type) after prenatal diagnosis done by amniocentesis at 15 weeks of gestation.
