Skip to main content

X-linked inheritances recessive of congenital nystagmus and autosomal dominant inheritances of congenital cataracts coexist in a Chinese family: a case report and literature review



Congenital nystagmus (CN) and congenital cataracts are distinct eye diseases and are usually isolated. Cases with CN and congenital cataracts caused by different genes in one family have been rarely reported.

Case presentation

A 27-year-old man presented with CN and congenital cataracts and he underwent cataract extraction 2 weeks after birth. Three years later, he had posterior chamber intraocular lens implantation. The proband’s mother was only afflicted by bilateral lens opacities. Lensectomy was performed in both eyes at age 15. The proband’s daughter had bilateral central cataracts and no nystagmus. She had undergone cataract extraction when she was two months old. In this family, 8 affected individuals were affected by bilateral cataracts, and three of them presented with CN. The genetic analysis was performed using a specific Hereditary Ophthalmological Disease Gene Panel on proband and his parents (one of which was a patient). PCR and Sanger sequencing verified the presence of these variants in all members of the family. The novel mutation, c.498-3C > T, in FRMD7 explains why X-Linked recessive inheritance of CN was found in a subset of patients. A heterozygous mutation of the GJA8 gene (c.139G > C), was identified in all patients and thus explains the autosomal dominant pattern of inheritance of congenital cataracts within the family.


This is the first time that FRMD7 and GJA8 gene mutations have been linked to the pathogenesis of a family with both CN and congenital cataracts. The phenomenon of two different genetic patterns coexisting in one family is rare.

Peer Review reports


Congenital nystagmus (CN) are ocular motor disorders in which patients are afflicted by periodic involuntary ocular oscillations affecting both eyes [1, 2]. Disease onset normally occurs at birth or develops shortly thereafter. The inheritance model of CN has been previously described in various forms as being either autosomal or X-linked, and either dominant or recessive, with X-linked inheritance and incomplete penetrance being the most common [3]. Three distinct X-linked loci are known: Xp11.4-p11.3, Xq26-Xq27, and Xp22.3-p22.2 [4,5,6]. The Xq26-q27 and Xp22.3-p22.2 regions contain genes coding for FERM domain-containing 7 (FRMD7) and G-protein coupled receptor 143 (GPR143), respectively, and both of these genes have been identified as contributors to CN disease [6, 7]. The GPR143 gene is also associated with X-linked ocular albinism type 1 (OA1) [8, 9].

Congenital cataracts are by far the most common explanation for blindness in children globally, with such blindness being characterized by lens opacity [10]. It is estimated that blindness occurs in approximately 1–6 of every 10,000 births in highly developed countries, and at higher rates of 5–15 per 10,000 births in those countries which are poorer [11,12,13]. As many as one in three congenital cataracts are believed to be linked to specific genetic mutations [14, 15]. Over 48 genes have been identified in the inherited forms of isolated or primary cataracts with minimal other ocular signs [15]. Most often, inherited cataracts not associated with another known disease present a pattern of autosomal dominant (AD) inheritance, but this is not always the case and in some instances X-linked or autosomal recessive (AR) versions are evident [16].

In our study, four generations of a family from China afflicted CN and congenital cataracts were recruited. Some of the affected individuals exhibited CN, and all were afflicted by congenital cataracts. Patients were sequenced to find candidate genes within the family. We identified two different genetic patterns that coexist in the family. Mutations in FRMD7 and GJA8 genes were responsible for the pathogenesis of CN and congenital cataracts respectively.

Case presentation

The proband (patient III: 1, Fig. 1a, Fig. 1b, Fig. 2a) is a 27-year-old who previously underwent cataract extraction 2 weeks after birth. Three years later, he had posterior chamber intraocular lens implantation but he did not receive any amblyopia treatment, nor did he use aphakic spectacle for visual rehabilitation following the two surgeries. He was found to have nystagmus on the fortieth day after birth and was diagnosed with CN. His daughter (IV: 1) had bilateral central cataracts and no nystagmus. She had undergone cataract extraction when she was two months old. Visual rehabilitation via aphakic spectacle correction using + 20 diopter sphere (DS) in the right eye and + 21DS in the left eye was performed.

Fig. 1

Slit-lamp photograph of patients who had congenital cataracts. a: Right eye of the proband III:1. The pupil is upward. Thickened capsule can be seen. Intraocular lens is located in the right position. b: Left eye of the proband III:1. The pupil is not round. Intraocular lens is located in the right position. c: Right eye of patient III: 3. Pupil is not perfectly round. d: Left eye of patient III:3. Pupil is round. Intraocular lens is located in the right position. e: Right eye of patient II:1. Irregularly shaped pupil can be seen. Aphakia. f: Left eye of patient II:1. The iris has anterior adhesion from the 3 o’clock to 5 o’clock position. g: Right eye of patient II:3. There is a hole of circumferential iridectomy. Intraocular lens is located in the right position. h: Left eye of patient II:3. The pupil deformation is severe with capsule thickened

Fig. 2

GJA8 and FRMD7 mutations in this family. a and c The GJA8 heterozygous mutation c.139G > C was found in all patients and likely is responsible for the autosomal dominant pattern of inheritance of congenital cataracts in this family. b and d The FRMD7 splicing variant c.498-3C > T was found in I:1, III:1 and III:3; thus, this variant likely plays a role in CN’s X-Linked recessive inheritance

The proband’s brother (III: 3, Fig. 1c, Fig. 1d) had bilateral cataracts and conjugate horizontal nystagmus. He underwent cataracts extracted at age 6 and had an intraocular lens implanted at age 11. The proband’s mother (II:1, Fig. 1e, Fig. 1f) was additionally afflicted by bilateral lens opacities. Lensectomy was performed in both eyes at age 15. The proband’s uncle (II:3, Fig. 1g, Fig. 1h) also had bilateral congenital cataracts without nystagmus. He had phacoemulsification cataract extraction and intraocular lens implantation when he was 28 years old. His two daughters (III: 4, III: 5) were found to have bilateral central cataracts without nystagmus. They both had phacoemulsification cataract extractions and intraocular lens implantations when they were 9 years old. The patient features are described in Table 1 and this family was recruited from West China Hospital, Sichuan University. All participants were informed about the purpose of the protocol and signed consent forms. The protocol was approved by the Ethics Committee of West China Hospital, Sichuan University.

Table 1 Summary of clinical features of patients

Patient III:1, his mother (II:1, patient) and his father (II:1, normal) were sequenced by with a specific Hereditary Ophthalmological Disease Gene Panel. DNA was extracted using QIAamp DNA blood mini kit (Qiagen) and exons coinciding with genes of interest being captured via the Panel with biotinylated oligo-probes (GenCap Enrichment Technologies, MyGenostics, Beijing). A total of 662 genes, including most known to related to hereditary ophthalmological disease, were included in this panel (see Additional file 1: Table S1). An Illumina Solexa HiSeq 2000 sequencer (MyGenostics, Beijing) was used for sample sequencing. Bioinformatics analysis was performed to identify the mutations were linked to the disease phenotype present in the affected family. Sanger sequencing was verified the variants in other individuals using primers: FRMD7 (NG_012347) forward primer CATCTGGCACAAACTCGGTA and reverse primer CTCTTAAAACTCAACTTGCGGA. GJA8 (NG_016242) forward primer GAACATCTTGGAGGAGGTGAAT and reverse primer CAGAGGCGAATGTGGGAGAT.

More than 99% of the targeted regions were covered in each sample. Using bioinformatics analysis, two candidate mutations were identified in this family. A heterozygous mutation in GJA8 gene (chr1–14,738,022, exon2, c.139G > C, p.D47H, NM_005267.4) and a novel FRMD7 gene splicing mutation (chrX-131,219,759, exon7, c.498-3C > T, splicing, NM_194277.2) were found in patient III:1 (Other variants results of Patient III:1 to see Additional file 2: Table S2). The c.139G > C mutation of GJA8 gene was found in ClinVar database ( (Clinical significance: Pathogenic) and not found in gnomAD database. The c.498-3C > T mutation of FRMD7 gene was not found in ClinVar database and gnomAD database. Segregation analysis was performed in the other family members using Sanger sequencing. The GJA8 heterozygous mutation c.139G > C was found in all patients and is likely responsible for autosomal dominant inheritance of congenital cataracts (Fig. 2a, Fig. 2c). The FRMD7 splicing variant c.498-3C > T was found in I:1, III:1 and III:3. II:1 and IV:1 were carriers (Fig. 2b, Fig. 2d). This segregation pattern is consistent with X-Linked recessive inheritance. These two mutations had paternal origin and came down from I:1, and the mutations were absent in those family members unaffected by disease. The sequence results of all the patients and some normal family members were shown in the Additional file 3: Figure S1 and Additional file 4: Figure S2.

A computational analysis of the D47H GJA8 mutant using a Polymorphism Phenotyping (PolyPhen-2) analysis yielded a result predicting this mutation to be “probably damaging”, while Sorting Intolerant From Tolerant (SIFT) analysis similarly suggested an intolerant substitution. Human FRMD7 is 2145 bp in length, with a total of 12 exons. A novel splice variant c.498-3C > T of FRMD7 had been found comparing with the original form of FRMD7. A novel isoform of FRMD7 arises through the alternative splicing of FRMD7 mRNA, leading to the deletion of 148 bp in exon 4. Through the “Deep Learning” algorithm of SPIDEX, the dpsi_max_tissue score was − 0.1228, and the dpsi_z score was − 0.514. The score range is − 100 to 100. The closer the absolute value of the score is to 100, the greater the influence of mRNA splicing. The dbscSNV analysis found that the ada_score was 0.6943564 (the score range is 0–1, the greater the score is, the greater the impact; the normal value is no more than 0.6), and the rf_score was 0.232 (the score range is 0–1; the greater the score is, the greater the impact; the normal value is no more than 0.6). If one of these scores is greater than 0.6, dbscSNV is T (TRUE), and otherwise, it is F (FALSE) (Table 2). Accordingto the ACMG guidelines, the c.139G > C variation of GJA8 gene was “pathogenic” and the c.498-3C > T variation of FRMD7 gene was “likely pathogenic”.

Table 2 In Silico Prediction of c.139G > C of GJA8 and c.498-3C > T of FRMD7

Discussion and conclusions

A Chinese family affected both by CN and by congenital cataracts was reported in our study. The phenomenon of two different types of eye diseases with different genetic patterns of inheritance in a family is very rare. No similar results have been reported.

The D47H GJA8 mutation has previously been linked to congenital nuclear and zonular pulverulent cataracts, and has the same cataract type as this family [17]. The GJA8 coding region consists of one exon and encodes 432 amino acids. Over 24 distinct GJA8 mutations have been reported to date in humans and in mouse models, with direct evidence that these mutations promote the formation of cataracts [18]. The c.139G > C substitution leads to the substitution of a histidine in place of aspartic acid at position 47, leading to a change from negative to positive charge [17]. Aspartic acid at position 47 is found in the extracellular loop E1 region of GJA8 [19]. Consistent with Li’s study, our PolyPhen and SIFT results suggest that D47H is a likely loss-of-function mutation [17].

It has been reported that the knockout of GJA8 in mice results in cataract development the impairment of lens growth [20]. GJA8 is highly expressed in both epithelial and lens fiber cells, particularly during their differentiation [21]. The mutated GJA8 alters lens fiber cell formation, which in turn leads to cataract formation [20].

FRMD7 mutations are major causes of CN [7]. FRMD7 expression is primarily detectable within the retina and vestibular system, with additional expression in portions of the brain regulating the vestibulo-ocular reflex [7, 22]. It has been reported that FRMD7 is important to facilitate neuronal circuit asymmetry for directional selectivity [23]. Nevertheless, exactly what role is played by FRMD7 is still uncertain. The protein encoded by FRMD7 has an N-terminal FERM domain that may facilitate signal transduction, similar to other proteins in this family with this same domain [23].

Interestingly, most mutations leading to congenital nystagmus are located in this FERM domain [22].

A FRMD7 splice variant (FRMD7-S) has previously been cloned and identified. This variant form may be important in the context of neuronal differentiation and development [24]. Another splice variant, FRMD7 (FRMD7_SV2), is similarly predicted to be important for neuron development [25]. The FRMD7 mutation of c. 206-5 T > A is predicted to disrupt the splice acceptor site in the third intron, while variant c.205 + 2 T > G is predicted to be pathological on the basis of its likelihood to induce nonsense-mediated decay or exon skipping [26]. In this family, a novel splice variant of FRMD7, c.498-3C > T, has been identified. This splice variant was predicted to be harmful using bioinformatics analysis and this variant is likely the causative lesion for CN in this family.

In summary, this study reveals two variants of two genes. These variants explain two clinical pathologies with different inheritance patterns in a Chinese family. The exact means by which these variants result in CN and congenital cataracts at the molecular level remains to be determined, and further functional studies will be necessary to offer novel insights into this inherited ocular disease.



autosomal dominant


autosomal recessive


Congenital nystagmus


diopter sphere


FERM domain-containing 7


G-protein coupled receptor 143


ocular albinism type 1


Polymorphism Phenotyping


Sorting Intolerant From Tolerant


  1. 1.

    Casteels I, Harris CM, Shawkat F, Taylor D. Nystagmus in infancy. Br J Ophthalmol. 1992;76(7):434–7.

    CAS  Article  Google Scholar 

  2. 2.

    Abadi RV, Bjerre A. Motor and sensory characteristics of infantile nystagmus. Br J Ophthalmol. 2002;86(10):1152–60.

    CAS  Article  Google Scholar 

  3. 3.

    Oetting WS, Armstrong CM, Holleschau AM, DeWan AT, Summers GC. Evidence for genetic heterogeneity in families with congenital motor nystagmus (CN). Ophthalmic Genet. 2000;21(4):227–33.

    CAS  Article  Google Scholar 

  4. 4.

    Cabot A, Rozet JM, Gerber S, Perrault I, Ducroq D, Smahi A, et al. A gene for X-linked idiopathic congenital nystagmus (NYS1) maps to chromosome Xp11.4-p11.3. Am J Hum Genet. 1999;64(4):1141–6.

    CAS  Article  Google Scholar 

  5. 5.

    Kerrison JB, Vagefi MR, Barmada MM, Maumenee IH. Congenital motor nystagmus linked to Xq26-q27. Am J Hum Genet. 1999;64(2):600–7.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  6. 6.

    Liu JY, Ren X, Yang X, Guo T, Yao Q, Li L, et al. Identification of a novel GPR143 mutation in a large Chinese family with congenital nystagmus as the most prominent and consistent manifestation. J Hum Genet. 2007;52(6):565–70.

    Article  PubMed  Google Scholar 

  7. 7.

    Tarpey P, Thomas S, Sarvananthan N, Mallya U, Lisgo S, Talbot CJ, et al. Mutations in FRMD7, a newly identified member of the FERM family, cause X-linked idiopathic congenital nystagmus. Nat Genet. 2006;38(11):1242–4.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  8. 8.

    Bassi MT, Schiaffino MV, Renieri A, De Nigris F, Galli L, Bruttini M, et al. Cloning of the gene for ocular albinism type 1 from the distal short arm of the X chromosome. Nat Genet. 1995;10(1):13–9.

    CAS  Article  PubMed  Google Scholar 

  9. 9.

    Mackey DA. 2005 Gregg lecture: congenital cataract--from rubella to genetics. Clin Exp Ophthalmol. 2006;34(3):199–207.

    Article  PubMed  Google Scholar 

  10. 10.

    Shiels A, Hejtmancik JF. Genetic origins of cataract. Arch Ophthalmol. 2007;125(2):165–73.

    CAS  Article  PubMed  Google Scholar 

  11. 11.

    Holmes JM, Leske DA, Burke JP, Hodge DO. Birth prevalence of visually significant infantile cataract in a defined U.S. population. Ophthalmic Epidemiol. 2003;10(2):67–74.

    Article  Google Scholar 

  12. 12.

    Vogt G, Puho E, Czeizel AE. Population-based case-control study of isolated congenital cataract. Birth Defects Res A Clin Mol Teratol. 2005;73(12):997–1005.

    CAS  Article  PubMed  Google Scholar 

  13. 13.

    Apple DJ, Ram J, Foster A, Peng Q. Elimination of cataract blindness: a global perspective entering the new millenium. Surv Ophthalmol. 2000;45(Suppl 1):S1–196.

    PubMed  Google Scholar 

  14. 14.

    Hejtmancik JF, Smaoui N. Molecular genetics of cataract. Dev Ophthalmol. 2003;37:67–82.

    CAS  Article  Google Scholar 

  15. 15.

    Shiels A, Hejtmancik JF. Molecular genetics of cataract. Prog Mol Biol Transl Sci. 2015;134:203–18.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  16. 16.

    Pichi F, Lembo A, Serafino M, Nucci P. Genetics of congenital cataract. Dev Ophthalmol. 2016;57:1–14.

    Article  PubMed  Google Scholar 

  17. 17.

    Li J, Wang Q, Fu Q, Zhu Y, Zhai Y, Yu Y, et al. A novel connexin 50 gene (gap junction protein, alpha 8) mutation associated with congenital nuclear and zonular pulverulent cataract. Mol Vis. 2013;19:767–74.

    CAS  PubMed  PubMed Central  Google Scholar 

  18. 18.

    Wang L, Luo Y, Wen W, Zhang S, Lu Y. Another evidence for a D47N mutation in GJA8 associated with autosomal dominant congenital cataract. Mol Vis. 2011;17:2380–5.

    CAS  PubMed  PubMed Central  Google Scholar 

  19. 19.

    Maeda S, Nakagawa S, Suga M, Yamashita E, Oshima A, Fujiyoshi Y, et al. Structure of the connexin 26 gap junction channel at 3.5 a resolution. Nature. 2009;458(7238):597–602.

    CAS  Article  PubMed  Google Scholar 

  20. 20.

    White TW. Unique and redundant connexin contributions to lens development. Science. 2002;295(5553):319–20.

    CAS  Article  PubMed  Google Scholar 

  21. 21.

    Gu S, Yu XS, Yin X, Jiang JX. Stimulation of lens cell differentiation by gap junction protein connexin 45. 6 Investigative ophthalmology & visual science. 2003;44(5):2103–11.

    Article  Google Scholar 

  22. 22.

    Thomas MG, Crosier M, Lindsay S, Kumar A, Thomas S, Araki M, et al. The clinical and molecular genetic features of idiopathic infantile periodic alternating nystagmus. Brain. 2011;134(Pt 3):892–902.

    Article  PubMed  PubMed Central  Google Scholar 

  23. 23.

    Yonehara K, Fiscella M, Drinnenberg A, Esposti F, Trenholm S, Krol J, et al. Congenital nystagmus gene FRMD7 is necessary for establishing a neuronal circuit asymmetry for direction selectivity. Neuron. 2016;89(1):177–93.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  24. 24.

    Li Y, Pu J, Liu Z, Xu S, Jin F, Zhu L, et al. Identification of a novel FRMD7 splice variant and functional analysis of two FRMD7 transcripts during human NT2 cell differentiation. Mol Vis. 2011;17:2986–96.

    CAS  PubMed  PubMed Central  Google Scholar 

  25. 25.

    Li Y, Pu J, Zhang B. Expression of a novel splice variant of FRMD7 in developing human fetal brains that is upregulated upon the differentiation of NT2 cells. Experimental and therapeutic medicine. 2014;8(4):1131–6.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

  26. 26.

    Thomas MG, Crosier M, Lindsay S, Kumar A, Araki M, Leroy BP, et al. Abnormal retinal development associated with FRMD7 mutations. Hum Mol Genet. 2014;23(15):4086–93.

    CAS  Article  PubMed  PubMed Central  Google Scholar 

Download references


We thank the patient in this case study and his family for participating in the study. We would like to thank MyGenostics (Beijing) for providing computational analysis.


This work was supported by the National Natural Science Foundation of China (NSFC) (grant no. 81500697), including study design, data analysis and writing the manuscript.

Availability of data and materials

The relevant data were generated during this study and included in this article (see supplementary information files). And raw sequence data were not applicable to share in this article as no datasets were generated during the current study.

Author information




NY, LX and KM carried out the experiments, prepared the figures, and drafted the manuscript. CH and B.G. performed bioinformatics analysis of sequencing data. WF and YD conceived the study, participated in its design and coordination. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Ke Ma.

Ethics declarations

Ethics approval and consent to participate

This study was approved by the Ethics Committee of West China Hospital, Sichuan University. All participants were informed about the purpose of the protocol and signed consent forms. The guardian (parent) of the patients (under the age of 16) consented to participation of the study.

Consent for publication

Written informed consent was obtained from the patient for publication of this Case Report. The guardian (parent) of the patients (under the age of 18) consented to publication of the study. The guardian (parent) of the patients consented for their medical information to be published.

Competing interests

The authors declare that they have no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Additional files

Additional file 1:

Table S1. The panel of genes screened for the family (662) (XLSX 17 kb)

Additional file 2:

Table S2. Other variants results of Patient III:1. (XLSX 14 kb)

Additional file 3:

Figure S1. Sanger sequence of GJA8 gene. The sequence results of GJA8 c.139G > C mutation in all the patients and some normal family members. (TIF 3118 kb)

Additional file 4:

Figure S2. Sanger sequence of FRMD7 gene. The sequence results of FRMD7 c.498-3C > T splicing variant in all the patients and some normal family members. (TIF 2876 kb)

Rights and permissions

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (, which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver ( applies to the data made available in this article, unless otherwise stated.

Reprints and Permissions

About this article

Verify currency and authenticity via CrossMark

Cite this article

Yan, N., Xiao, L., Hou, C. et al. X-linked inheritances recessive of congenital nystagmus and autosomal dominant inheritances of congenital cataracts coexist in a Chinese family: a case report and literature review. BMC Med Genet 20, 41 (2019).

Download citation


  • Case report
  • Congenital nystagmus
  • Congenital cataracts
  • FRMD7
  • GJA8
  • Chinese pedigree