- Research article
- Open Access
- Published:
1Novel MEFV transcripts in Familial Mediterranean fever patients and controls
BMC Medical Genetics volume 11, Article number: 87 (2010)
Abstract
Background
Familial Mediterranean fever is a recessive autoinflammatory disease frequently encountered in Armenians, Jews, Arabs and Turks. The MEFV gene is responsible for the disease. It encodes a protein called pyrin/marenostrin involved in the innate immune system. A large number of clinically diagnosed FMF patients carry only one MEFV mutation. This study aims at studying the MEFV gene splicing pattern in heterozygous FMF patients and healthy individuals, in an attempt to understand the mechanism underlying the disease in these patients.
Methods
RNA was extracted from peripheral blood leucocytes of 41 FMF patients and 34 healthy individuals. RT-PCR was then performed, and the amplified products were migrated on a polyacrylamide electrophoresis gel, characterized by gel extraction of the corresponding bands followed by sequencing.
Results
Five novel splicing events were observed in both patients and controls deleting either exons 3, 4 (del34), or exons 2, 3, 4 (del234), or exons 2, 3, 4, 5 (del2345) or exon7 (del7) or exons 7 and 8 (del78).
Conclusions
The observation of such qualitative variability in the expression of the MEFV gene suggests a complex transcriptional regulation. However, the expression of these novel transcripts in both patients and controls is not in favour of a severe pathogenic effect.
Background
Familial Mediterranean fever (FMF) is an autoinflammatory autosomal recessive disease particularly frequent around the Mediterranean basin. It is characterized by recurrent bouts of fever and serosal inflammation, the most severe manifestation of the disease being renal amyloidosis [1]. The MEFV gene on chromosome 16p13.3, responsible for this disease [2, 3], is composed of 10 exons. Over 80 MEFV mutations were detected in FMF patients and registered in the autoinflammatory mutation database Infevers http://fmf.igh.cnrs.fr/infevers/[4]. Five of these mutations (M694V, M694I, V726A, M680I and E148Q) were mostly encountered in the mainly affected populations, namely Jews, Armenians, Arabs and Turks [5]. MEFV encodes a 781 amino acids' protein named pyrin or marenostrin (P/M) that is involved in the inflammatory pathways of the innate immune system [6]. Sequence alignment of the protein revealed 6 domains: a pyrin domain (or PyD), a bZIP basic domain, a B-box zinc finger domain, a coiled coil domain, 2 nuclear localization signals domains and a Ret Finger protein (RFP or B30.2) domain, also known as SPRY domain [7, 8].
MEFV is expressed in neutrophils, eosinophils, monocytes [9, 10] and to a lesser extent in skin and peritoneal fibroblasts [11]. Several alternatively spliced MEFV transcripts have been previously described. The first one (MEFV-d2) was identified in peripheral blood leukocytes (PBLs) and lacks exon 2 [12]. Diaz et al. characterized 3 other transcripts in synovial fibroblasts from osteoarthritis affected patients, one substituting exon 2a for exon 2 (2a), one with an extra exon corresponding to a sequence in intron 4 (4a), and one with an extension of exon 8 (8ext) [13]. Moreover, MEFV-d2 and 2a combined with 4a or 8ext to form four other transcripts: Δ2/4a, 2a/4a, Δ2/8ext and 2a/8ext. The various combinations of 4a and 8ext result in a frameshift leading to putative truncated proteins [13].
Clinical diagnosis is often confirmed by genetic testing of the MEFV gene. However, in an important number of clinically diagnosed FMF patients, only one MEFV mutation was detected by screening of the genomic MEFV coding sequence [5, 14]. In the present study, we examined the splicing pattern of MEFV in normal and FMF PBLs, in an attempt to understand the mechanism underlying FMF in the clinically diagnosed patients carrying only one MEFV mutation. A qualitative analysis of MEFV transcripts was conducted in 41 FMF patients and 34 healthy individuals. Results were compared, and plotted to the patient genotype data. Our study did not show evidence for any correlation between genotypes and splicing, but revealed 5 novel transcripts which increases the number of transcripts identified in human leukocytes.
Methods
Human material from FMF patients and controls
This study included 2 series consisting of 41 unrelated Lebanese FMF patients who fulfilled international diagnostic FMF criteria [15] and 34 Lebanese healthy individuals. 36 of the FMF patients had only one identifiable exonic mutation and 5 patients had 2 mutations (Table 1). Written consent was obtained from all individuals, and the work was approved by the Saint Joseph University ethical committee. Blood was collected into tubes containing heparin, and whole PBLs were purified by lysis of the red cells with blood lysis buffer according to standard protocols.
RT-PCR analysis
Total RNAs were extracted from PBLs using the phenol chloroform method, then retro-transcribed (RT) into complementary DNA (cDNA) using random primers. Two sets of Polymerization Chain Reaction (PCR) were run on the MEFV cDNAs. The 5' amplicon was obtained with primers 5' AGCCAGATCCAGAGAGCCA 3' in exon 1 and 5' CCTGTGCAAGATGTCTCCAA 3' in exon 6 and the 3' amplicon with primers 5' TGCAGAGGAAGCTGGAGCA 3' in exon 5 and 5' ACCTCCACCTCCCAGTAACGG 3' in exon 10. The amplified products were migrated on a polyacrylamide gel and characterized by extraction of the corresponding bands from the gel then sequencing on an ABI Prism 3130 genetic analyzer.
Results
The studied series were screened for the presence of splicing events by RT-PCR. Two overlapping fragments of MEFV cDNA, one from exon 1 to 6, and one from exon 5 to 10, were amplified. Normal transcripts were detected, in addition to the already described transcript, MEFV-d2, that was variously expressed (Figure 1).
Two representative RT-PCR electrophoresis gels showing the novel isoforms observed from the 5' amplified segment (left) and the 3' amplified segment (right) of the MEFV transcripts in heterozygous patients and healthy controls. The 2 amplicons span respectively the region between exons 1 and 6 and the region between exons 5 and 10.
L = 100 basepair DNA ladder (Fermentas).
Five novel alternative splicing events were identified in both patients and controls. Three of them were observed from the 5' PCR products which lacked either exons 2 to 4 (del234), exons 2 to 5 (del2345) or exons 3 and 4 (del34) (Figure 1, left panel). Two other alternative splicing events were identified in the 3' fragment, one lacking exon 7 (del7), and one lacking exons 7 and 8 (del78) (Figure 1, right panel). The deletion boundaries were characterized by sequencing (Figure 2). This revealed that the splicing events derived from the MEFV canonical splice-sites.
The distribution of the 5 new splicing events (Table 1) showed that del7 and del78 were always found together in a given individual. del234, del7 and del78 were found in the majority of the individuals. No correlation was observed between the new alternative splicing events and the MEFV exonic mutations, and no significant difference was elicited between the genetically confirmed FMF patients, the apparently heterozygous patients and the healthy individuals.
Discussion
The detection of only one MEFV mutation in clinically diagnosed FMF patients and the highly variable phenotype among FMF patients (even those having the same MEFV genotype) have always been a subject of concern. Modifying genes could be a possible explanation for such observations, as well as the fact that only one MEFV mutation may cause the disease that could be dominant with a variable expressivity. Diseases which pattern of inheritance could be recessive in some families, and dominant in others have already been described [16]. This work aimed at investigating the expression pattern of the MEFV gene and trying to relate it to the clinical picture of the patients.
The study of MEFV transcripts in clinically diagnosed FMF patients having one or two MEFV mutations and in healthy controls revealed 5 novel exon skipping events (del234, del2345, del34, del7 and del78) (Figures 1 and 2), and one previously reported one (MEFV-d2) [12]. Skipping of exons 2 to 4, 7 and 7-8 were the most frequently observed events (Table 1).
Molecular events that could cause these alternative spliced transcripts are still unclear. Sequencing of introns 6 and 7 did not show any relevant sequence variation in the tested individuals. Furthermore, the absence of correlation between the MEFV point mutations harboured by the patients and controls, and the observed transcripts does not support impairment of splicing regulatory elements that would result in exon skipping [17]. The selective presence of these transcripts among individuals, suggests they might be due to modifying genes or to some external factor such as a reaction to an allergen.
The presence of these novel alternative splicing events in both controls and FMF patients' PBLs seems not in favour of a causal effect of these transcripts in the disease pathogenesis. Previous quantitative studies aiming at correlating disease and MEFV mRNA expression showed inconsistent results. MEFV transcript levels decreased significantly in FMF patients as compared to controls in the initial reports [18, 19], but no significant difference was evidenced in a more recent series [20]. The present study opens a new trail to be addressed regarding the FMF pathophysiology in that the patient's phenotype could be modulated by variations of the different transcripts' ratio. Such a molecular mechanism has been recently described in cystic fibrosis patients who displayed altered regulation of Toll-like Receptor-4 splice variants [21]. A larger series is warranted to replicate our findings. Further analyses of the relative amounts of each transcript are also necessary to confirm or rule out their role in the pathogenic mechanisms underlying inflammation in FMF patients.
Conclusions
In conclusion, we identified 5 novel MEFV splicing events observed in both clinically diagnosed FMF patients and controls. The observation of such qualitative variability in the expression of the MEFV gene suggests that this gene is subjected to a complex transcriptional and post-transcriptional regulation. The relative production of the different transcripts is a possibility that could modulate the physiopathological aspect of the disease.
References
Sohar E, Gafni J, Pras M, Heller H: Familial Mediterranean Fever. A survey of 470 cases and review of the literature. Am J Med. 1967, 43: 227-253. 10.1016/0002-9343(67)90167-2.
The French FMF Consortium: A candidate gene for familial Mediterranean fever. Nat Genet. 1997, 17: 25-31. 10.1038/ng0997-25.
The International FMF Consortium: Ancient missense mutations in a new member of the RoRet gene family are likely to cause familial Mediterranean fever. Cell. 1997, 90: 797-807. 10.1016/S0092-8674(00)80539-5.
Milhavet F, Cuisset L, Hoffman HM, Slim R, El-Shanti H, Aksentijevich I, Lesage S, Waterham H, Wise C, Sarrauste de Menthiere C, Touitou I: The infevers autoinflammatory mutation online registry: update with new genes and functions. Hum Mutat. 2008, 29 (6): 803-808. 10.1002/humu.20720.
Touitou I: The spectrum of familial Mediterranean fever (FMF) mutations. Eur J Hum Genet. 2001, 9: 473-483. 10.1038/sj.ejhg.5200658.
Gumucio DL, Diaz A, Schaner P, Richards N, Babcock C, Schaller M, Cesena T: Fire and ice: The role of pyrin domain-containing proteins in inflammation and apoptosis. Clin Exp Rheumatol. 2002, 20 (4 Suppl 26): S45-S53.
Centola M, Aksentijevich I, Kastner DL: The hereditary periodic fever syndromes: molecular analysis of a new family of inflammatory diseases. Hum Mol Genet. 1998, 7 (10): 1581-1588. 10.1093/hmg/7.10.1581.
Martinon F, Hoffman K, Tschopp J: The pyrin domain: a possible member of the death domain-fold family implicated in apoptosis and inflammation. Curr Biol. 2001, 10: R118-R120. 10.1016/S0960-9822(01)00056-2.
Centola M, Wood G, Frucht DM, Galon J, Aringer M, Farrell C, Kingma DW, Horwitz ME, Mansfield E, Holland SM, O'Shea JJ, Rosenberg HF, Malech HL, Kastner DL: The gene for familial Mediterranean fever, MEFV, is expressed in early leukocyte development and is regulated in response to inflammatory mediators. Blood. 2000, 95 (10): 3223-3231.
Tidow N, Chen X, Müller C, Kawano S, Gombart AF, Fischel-Ghodsian N, Koeffler HP: Hematopoietic-specific expression of MEFV, the gene mutated in familial Mediterranean fever, and subcellular localization of its corresponding protein, pyrin. Blood. 2000, 95 (4): 1451-1455.
Matzner Y, Abedat S, Shapiro E, Eisenberg S, Bar-Gil-Shitrit A, Stepensky P, Calco S, Azar Y, Urieli-Shoval S: Expression of the familial Mediterranean fever gene and activity of the C5a inhibitor in human primary fibroblast cultures. Blood. 2000, 96 (2): 727-731.
Papin S, Duquesnoy P, Cazeneuve C, Pantel J, Coppey-Moisan M, Dargemont C, Amselem S: Alternative splicing at the MEFV locus involved in familial Mediterranean fever regulates translocation of the marenostrin/pyrin protein to the nucleus. Hum Mol Genet. 2000, 9 (20): 3001-3009. 10.1093/hmg/9.20.3001.
Diaz A, Hu C, Kastner DL, Schaner P, Reginato AM, Richards N, Gumucio DL: Lipopolysaccharide-induced expression of multiple alternatively spliced MEFV transcripts in human synovial fibroblasts: a prominent splice isoform lacks the C-terminal domain that is highly mutated in familial Mediterranean fever. Arthritis Rheum. 2004, 50 (11): 3679-3689. 10.1002/art.20600.
Medlej-Hashim M, Serre JL, Corbani S, Saab O, Jalkh N, Delague V, Chouery E, Salem N, Loiselet J, Lefranc G, Mégarbané A: Familial Mediterranean fever (FMF) in Lebanon and Jordan: a population genetics study and report of three novel mutations. Eur J Med Genet. 2005, 48: 412-420. 10.1016/j.ejmg.2005.05.010.
Livneh A, Langevitz P, Zemer D, Zaks N, Kees S, Lidar T, Migdal A, Padeh S, Pras M: Criteria for the diagnosis of familial Mediterranean fever. Arthritis Rheum. 1997, 40 (10): 1879-1885. 10.1002/art.1780401023.
Hennekam RC: Hutchinson-Gilford progeria syndrome: review of the phenotype. Am J Med Genet A. 2006, 140 (23): 2603-2624.
Cartegni L, Wang J, Zhu Z, Zhang MQ, Krainer AR: ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acids Res. 2003, 31 (13): 3568-3571. 10.1093/nar/gkg616.
Notarnicola C, Didelot MN, Kone-Paut I, Seguret F, Demaille J, Touitou I: Reduced MEFV messenger RNA expression in patients with familial Mediterranean fever. Arthritis Rheum. 2002, 46 (10): 2785-2793. 10.1002/art.10575.
Ustek D, Ekmekci CG, Selçukbiricik F, Cakiris A, Oku B, Vural B, Yanar H, Taviloglu K, Ozbek U, Gül A: Association between reduced levels of MEFV messenger RNA in peripheral blood leukocytes and acute inflammation. Arthritis Rheum. 2007, 56 (1): 345-350. 10.1002/art.22320.
Booty MG, Chae JJ, Masters SL, Remmers EF, Barham B, Le JM, Barron KS, Holland SM, Kastner DL, Aksentijevich I: Familial Mediterranean fever with a single MEFV mutation: Where is the second hit?. Arthritis Rheum. 2009, 60 (6): 1851-1861. 10.1002/art.24569.
Jaresova I, Rozkova D, Spísek R, Janda A, Brazova J, Sediva A: Kinetics of Toll-like receptor-4 splice variants expression in lipopolysaccharide-stimulated antigen presenting cells of healthy donors and patients with cystic fibrosis. Microbes Infect. 2007, 9 (11): 1359-1367. 10.1016/j.micinf.2007.06.009.
Pre-publication history
The pre-publication history for this paper can be accessed here:http://www.biomedcentral.com/1471-2350/11/87/prepub
Acknowledgements
This work was supported by Scientific Research grants from the Saint Joseph University, Beirut, and by the Lebanese National Council for Scientific Research. We are also grateful to all the FMF patients who accepted to contribute to this study.
Author information
Authors and Affiliations
Corresponding author
Additional information
Competing interests
The authors declare that they have no competing interests.
Authors' contributions
MMH designed the project and wrote the article. NN looked for the patients and performed the RNA extraction and the RT-PCR followed by polyacrylamide gel electrophoresis and sequencing. EC helped in the results analysis, NJ assisted and participated in the experimental work, and AM directed and supervised the study.
Myrna Medlej-Hashim, Nancy Nehme contributed equally to this work.
Authors’ original submitted files for images
Below are the links to the authors’ original submitted files for images.
Rights and permissions
Open Access This article is published under license to BioMed Central Ltd. This is an Open Access article is distributed under the terms of the Creative Commons Attribution License ( https://creativecommons.org/licenses/by/2.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
About this article
Cite this article
Medlej-Hashim, M., Nehme, N., Chouery, E. et al. 1Novel MEFV transcripts in Familial Mediterranean fever patients and controls. BMC Med Genet 11, 87 (2010). https://doi.org/10.1186/1471-2350-11-87
Received:
Accepted:
Published:
DOI: https://doi.org/10.1186/1471-2350-11-87
Keywords
- Familial Mediterranean Fever
- Splice Event
- Familial Mediterranean Fever Patient
- Alternative Splice Event
- Autosomal Recessive Disease