The Database of Genomic Variants was queried for CNV within the BMPR2 gene. The database identified seven CNVs in intron 1 at locus 2q33.1: 202,992,448 – 203,030,002. The CNVs were partially overlapping, but had different endpoints (Figure 1). They were discovered using a variety of methodologies [6–12]. All seven CNV studies used samples from the International HapMap Project which includes individuals of European, Yoruba, Chinese, and Japanese ancestry.
We designed two sets of primers within the overlapping CNV region: CNV set 1 (GCATTGAAAGTGGGATAATGG, TGAAATTTGAGGATAACAATTTTAAG) and CNV set 2 (TAATTGCCTTCAGAGCAGGG, CCAACATTTGTCAAGGATGC). We designed two sets of control primers outside the CNV (one control primer set was placed within exon 1 of BMPR2 and the other control primer set was placed within exon 1 of BMPR1a): CNV set 1 (TTGTGATTCGCTCACAGGAG, AGAGGCTGCCCCTTCTAGTC) and CNV set 2 (TGGTAAAGGCCGATATGGAG, ATGTTTTCATGGCGCATTAG) (Figure 1).
Human genomic DNA was obtained with informed consent from 97 patients with approval from the Institutional Review Board at Vanderbilt University. Genomic DNA was isolated from whole blood using the Roche MagNA Pure LC DNA purification system (Roche Molecular Biochemicals, Indianapolis, IN). Of the 97 samples, there were 24 patients with familial PAH, 18 obligate carriers (BMPR2 mutation positive), 20 sporadic PAH patients, and 35 controls. Obligate carriers are patients without pulmonary hypertension, but with BMPR2 mutations. Controls were either married-in spouses (7), unaffected family members negative for the BMPR2 mutation (13), or unrelated healthy individuals (14). There were 21 families with familial PAH included, representing on average 113 BMPR2 alleles. In efforts to evaluate penetrance and anticipation, we included seven parent-child dyads. 93 patients were Caucasian and 4 patients were African American.
DNA samples were diluted to 2 ng/ml. Quantitative PCR with SYBR Green was performed to quantify genomic copies of CNV and controls. Samples were run in triplicates on an Applied Biosystems StepOnePlus machine. A dilution series was performed to quantify primer efficiency.