Skip to main content

Table 1 Technical characterization of the markers included in the panel

From: Investigation of INDEL variants in apoptosis: the relevance to gastric cancer

Gene ID Region Alleles MAF Primers Amplicon
BCL2 rs11269260 Intron TCTATCACCGATCATT/− 0.37 F5’GCTTCCAGTTCCATCCATGT3’
R5’CTCAGCGTGGTAGTGTTGGA3’
189–205
CASP3 rs4647655 Intron −/AAATCCTGAA 0.28 F5’AGGAGTATCCCCTCGTGGAC3’
R5’CAAGAGTCAGGCAAAAACAGG3’
379–389
CASP8 rs3834129 Promoter AGTAAG/− 0.39 F5’CTCTTCAATGCTTCCTTGAGGT3’
R5’CTGCATGCCAGGAGCTAAGTAT3’
249–255
CASP8 rs59308963 Intron ATTCTGTC/− 0.26 F5’TTTTTGTCCTCCAAGCTTCC3’
R5’GAACAAGAGAGAGGGCAGGA3’
261–269
CASP9 rs4645982 Intron −/TCCCCGCACTGACCTCACG 0.42 F5’GGTGACCCCAGAATTGACCCT3’
R5’GCCCTCAGGACGCACCTCTG3’
336–353
CASP9 rs61079693 Intron AAAA/− 0.32 F5’CATGCACAGCTATCCAGGAG3’
R5’TTGTTCCTGTCCGATAGATGC3’
458–462
FADD rs4197 3′ UTR −/TGT 0.47 F5’TGCCCCTACTTAGCAGTCTCA3’
R5’GAGAGGTGGAGAACTGGGATT3’
278–281
FAS rs10562972 Intron TTC/− 0.12 F5’GCATCAGGACGCTGAACATA3’
R5’AATGCAACTTGCTCCAGAGG3’
368–371
TP53 rs17880560 3′-Flanking −/GCCGTG 0.21 F5’CTGTGTGTCTGAGGGGTGAA3’
R5’ATCCTGCCACTTTCTGATGG3’
400–406