Skip to main content

Table 1 Primers used for this study

From: Genetic variants in CYP4F2 were significantly correlated with susceptibility to ischemic stroke

SNP_ID 1st-PCR primer 2nd-PCR primer UEP SEQ
rs3093203 ACGTTGGATGAAAGCCACCAATCCGCTATG ACGTTGGATGGGTCACATAGTGTACTGTCC ACATAGTGTACTGTCCTTTTATA
rs3093193 ACGTTGGATGGTGATGAGACTAGTGATCCC ACGTTGGATGGCCACATACACATTGATGGG GTTTAGATAAACAGCCACA
rs12459936 ACGTTGGATGGGTAACCATCATTCTGCTTC ACGTTGGATGAGAGGTCGCAGTAAGCTGAG CAGCCTGGGTGACAGAG
rs3093144 ACGTTGGATGGGGAAGAATTGTGGCAAAGG ACGTTGGATGAGGAGTCTCTCGTCCTTCTG AGTTAAAAAAAAAATCCTAGATACTT
rs3093110 ACGTTGGATGGTCTCATTGATAAGAGGGAG ACGTTGGATGTCCTGTTATGAGGGTACAGC CCGTCTCCCACTTCCAC
  1. SNP single nucleotide polymorphism, UEP SEQ Unextended mini-sequencing primer