Skip to main content

Table 1 Primers, restriction enzymes, and fragment lengths of the major and minor alleles of rs1799983, rs2070744, and VNTR polymorphisms of NOS3 gene

From: Association of NOS3 gene polymorphisms with essential hypertension in Sudanese patients: a case control study

  rs1799983 VNTR intron 4 rs2070744
Left primer (5′ to 3′) AGCCTCGGTGAGATAAAGGA AGGCCCTATGGTAGTGCCTT CCCCTGTGGACCAGATGC
Right primer (5′ to 3′) TCTTGAGAGGCTCAGGGATG TCTCTTAGTGCTGTGGTCAC ACATTAGGGTATCCCTTCC
Product size 368 bp   379 bp
Restriction enzyme BanII MboI   MspI
Major allele fragment length (bp) Cut, two fragments (251 and 117 bp) Not cut 420 (b) Two fragments, 146 and 233 bp
Minor allele fragment length (bp) Not cut, 368 bp Cut, two fragments (246 and 122 bp) 394 (a) Three fragments 46, 146, and 187 bp
Heterozygous    394 and 420 bp fragments Four fragments 46, 146, 187, and 233 bp