Skip to main content

Table 1 Primers of selected genes

From: Relationship of genetic causes and inhibin B in non obstructive azoospermia spermatogenic failure

Gene name Primers (forward/reverse)
SY133 5-ATTTCTCTGCCCTTCACCAG-3
5-TGATGATTGCCTAAAGGGAA-3
SY146 5-ACAAAAATGTGGCTCAGGGA-3
5-AAATAGTGTGCCCACCCAAA-3
SY153 5-GCATCCTCATTTTATGTCCA-3
5-CAACCCAAAAGCACTGAGTA-3
SY155 5-ATTTTGCCTTGCATTGCTAG-3
5-TTTTTAAGCCTGTGACCTGG-3
SY157 5-CTTAGGAAAAAGTGAAGCCG-3
5-CCTGCTGTCAGCAAGATACA-3
SY158 5-CTCAGAAGTCCTCCTAATAGTTCC-3
5-ACAGTGGTTTGTAGCGGGTA-3
SY182 5-TCAGAAGTGAAACCCTGTATG-3
5-GCATGTGACTCAAAGTATAAGC-3
SY238 5-AACAAGTGAGTTCCACAGGG-3
5-GCAAAGCAGCATTCAAAACA-3
SY254 5- GGGTGTTACCAGAAGGCAAA −3
5-GAACCGTATCTACCAAAGCAGC-3
SY255 5-GTTACAGGATTCGGCGTGAT-3
5-CTCGTCATGTGCAGCCAC-3
SY272 5-GGTGAGTCAAATTAGTCAATGTCC-3
5-CCTTACCACAGGACAGAGGG-3
SY277 5-GGGTTTTGCCTGCATACGTAATTA-3
5-CCTAAAAGCAATTCTAAACCTCCAG-3
SY283 5-CAGTGATACACTCGGACTTGTGTA-3
5-GTTATTTGAAAAGCTACACGGG-3