Skip to main content

Table 1 Primer pairs and PCR conditions for DHPLC analysis.

From: Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

HA Primer pairs and PCR conditions for DHPLC analysis
Exon primer Sequence (5' to 3') Length of PCR amplicon (bp) Annealing Temp. (°C) DHPLC oven (°C) Elution profile(B%)
1F ACATCCAGTGGGTAAAGTTC 356 53 60 55 56–65 52–61
1R AGACTTACATCCCCACAATC       
2F TTGAAGTGTCCACCAAAATGAACGACT 211 54 59   48–57  
2R GATACCCAATTTCATAAATAGCATTCA       
3F GTACTATCCCCAAGTAACCTT 204 54 59   50–59  
3R CATAGAATGACAGGACAATAGG       
4F TACAGTGGATATAGAAAGGAC 296 54 57   54–63  
4R TGCTTATTTCATCTCAATCCTACGCTT       
5F CCTCCTAGTGACAATTTCCTA 188 54 55   49–58  
5R AGCAGAGGATTTCTTTCAGGAATCCAA       
6F CATGAGACACCATGCTTAGCT 224 54 60   51–60  
6R AACTCTGGTGCTGAATTTGGAAGACCCT       
7F CAGATTCTCTACTTCATAGCCATAG 324 54 58 56 55–64 53–62
7R ATTAAAAGTAGGACTGGATA       
8F ATATAGCAAGACACTCTGACA 338 54 58   55–64  
8R AGAGAGTACCAATAGTCAAA       
9F AGAGTTGGATTTGAGCCTACC 284 54 58 55 53–62 50–59
9R CAGACTTTTTCTTCTTACCTGACCTT       
10F GGATTTGATCTTAGATCTCGC 204 53 56 54 50–59 48–57
10R ATTTTAGTTGTTATTGATGA       
11F TTGAGCTATTTATGGTTTTG 294 53 58.5 56 53–62 51–60
11R GACATACACTGAGAATGAA       
12F GCATTTCTTTACCCCTTTCA 230 54 59.5 57 51–60 49–58
12R CTTTATTCACCACCCACTG       
13F TCCTGGGAATAAGATAATGG 393 54 57.5 56 56–65 54–63
13R AGAGCATACGAATGGCTAGT       
14(I)F ATCTGTGTTATGAGTAACCA 430 54 57.5   57–66  
14(I)R TCATATTTGGCTTCTTGGAG       
14(II)F CATGGGCTATCCTTATCTGA 479 54 56.5   57–66  
14(II)R CATGAACTTTCTTGGCTATT       
14(III)F TCAAAGTTGTTAGAATCAGG 441 54 55.5   56–65  
14(III)R ATTTTGTGCATCTGGTGGAA       
14(IV)F GTCCAACAGAAAAAAGAGGG 481 54 57 54.5 58–67 55–64
14(IV)R CTACATTTTGCCTAGTGCTC       
14(V)F CTGGCACTAAGAATTTCATG 429 54 57.5 56 57–66 55–64
14(V)R CCTTCTCATTGTAGTCTATC       
14(VI)F GAAACATTTGACCCCGAGCA 431 54 57.5   56–65  
14(VI)R TTTTGGGCAAGTCTGGTTTC       
14(VII)F CACATACAAGAAAGTTGAGA 436 54 59 57.5 56–65 55–64
14(VII)R CTCATTTATTGCTGCTATTG       
14(VIII)F GATACCATTTTGTCCCTGAA 415 54 57.5   56–65  
14(VIII)R GTCACAAGAGCAGAGCAAAG       
15F CACCTAGGAAAATGAGGATGT 300 53 58.5 56 53–62 51–60
15R ATAGTCAGCAAGAAAATAAA       
16F AAGATCCTAGAAGATTATTC 330 50 57.5   53–62  
16R TTAGTACACAAAGACCATTT       
17F TGATGAGAAATCCACTCTGG 349 54 58 56.5 54–63 53–62
17R GTGCAATCTGCATTTCACAG       
18F GTGGAATCCTCATAGATGTCA 312 53 57   54–63  
18R GAGTAGGTAGAAGAAAGAGCAC       
19F GCAAGCACTTTGCATTTGAG 305 52 59 56 55–64 52–61
19R AGCAACCATTCCAGAAAGGA       
20F CCATTTTCATTGACTTACATTTGAG 193 53 59.5 56.5 49–58 46–55
20R AGATATAATCAGCCCAGGTTC       
21F GAATTTAATCTCTGATTTCTCTAC 168 53 60.5 56 48–57 46–55
21R GAGTGAATGTGAATACATTTCC       
22F AAATAGGTTAAAATAAAGTGTTAT 206 53 48   48–57  
22R GACTAATTACATACCATTAAG       
23F CTCTGTATTCACTTTCCATG 250 54 57   52–61  
23R ACAGTTAGTCACCCTACCCA       
24F GCTCAGTATAACTGAGGCTG 249 54 58.5   51–60  
24R CTCTGAGTCAGTTAAACAGT       
25F AGTGCTGTGGTATGGTTAAG 323 56 58 56.5 55–64 54–63
25R TTGCTCTGAAAATTTGGTCATA       
26F ATCCTGGACTACTGGAAACA 393 53 63 58.5 56–65 51–60
26R AGTTAATTCAGGAGGCTTCA