Skip to main content

Table 1 Sequences of oligonucleotide primers for allele-specific PCR

From: C4B null alleles are not associated with genetic polymorphisms in the adjacent gene CYP21A2in autism

CYP21A2 Mutations [ref] rs # Primer 5'-Sequence-3'
30 kb deletion [18]   common forward gcttcttgatgggtgatcaat
   rare forward tccccaatccttactttttgtc
   reverse cctcaatcctctgcagcg
V281L [17] rs6471 common reverse tccactgcagccatgtgcac
   rare reverse tccactgcagccatgtgcaa
   forward gagggatcacatcgtcgtggagatg
I172N [17] rs34607927 common forward tcctcacctgcagcatcat
   rare forward ctctcctcacctgcagcatcaa
   reverse agctgcatctccacgatgtga
R356W [17]   common reverse ctaagggcacaacgggccg
   rare reverse ctaagggcacaacgggcca
   forward gagggatcacatcgtcgtggagatg
P30L [17]   common forward tccggagcctccacctccc
   rare forward tccggagcctccacctcct
   reverse agctgcatctccacgatgtga
IN2 (656) A/C to G [17]   common forward (A) ttcccaccctccagcccccaa
   common forward (C) ttcccaccctccagcccccac
   rare forward ttcccaccctccagcccccag
   reverse agctgcatctccacgatgtga
Ex 3 (8 bp deletion) [17]   common forward cggacctgtccttgggagactac
   rare forward actacccggacctgtccttggtc
   reverse agctgcatctccacgatgtga
Ex 6 cluster   (see reference 17 for further description)
   L236N   common reverse agctgcatctccacgatgtga
   V237Q rs12530380 rare reverse tcagctgcttctcctcgttgtgg
   M239K rs6476 forward cggacctgtccttgggagactac