From: C4B null alleles are not associated with genetic polymorphisms in the adjacent gene CYP21A2in autism
CYP21A2 Mutations [ref] | rs # | Primer | 5'-Sequence-3' |
---|---|---|---|
30 kb deletion [18] | Â | common forward | gcttcttgatgggtgatcaat |
 |  | rare forward | tccccaatccttactttttgtc |
 |  | reverse | cctcaatcctctgcagcg |
V281L [17] | rs6471 | common reverse | tccactgcagccatgtgcac |
 |  | rare reverse | tccactgcagccatgtgcaa |
 |  | forward | gagggatcacatcgtcgtggagatg |
I172N [17] | rs34607927 | common forward | tcctcacctgcagcatcat |
 |  | rare forward | ctctcctcacctgcagcatcaa |
 |  | reverse | agctgcatctccacgatgtga |
R356W [17] | Â | common reverse | ctaagggcacaacgggccg |
 |  | rare reverse | ctaagggcacaacgggcca |
 |  | forward | gagggatcacatcgtcgtggagatg |
P30L [17] | Â | common forward | tccggagcctccacctccc |
 |  | rare forward | tccggagcctccacctcct |
 |  | reverse | agctgcatctccacgatgtga |
IN2 (656) A/C to G [17] | Â | common forward (A) | ttcccaccctccagcccccaa |
 |  | common forward (C) | ttcccaccctccagcccccac |
 |  | rare forward | ttcccaccctccagcccccag |
 |  | reverse | agctgcatctccacgatgtga |
Ex 3 (8 bp deletion) [17] | Â | common forward | cggacctgtccttgggagactac |
 |  | rare forward | actacccggacctgtccttggtc |
 |  | reverse | agctgcatctccacgatgtga |
Ex 6 cluster | Â | (see reference 17 for further description) | |
   L236N |  | common reverse | agctgcatctccacgatgtga |
   V237Q | rs12530380 | rare reverse | tcagctgcttctcctcgttgtgg |
   M239K | rs6476 | forward | cggacctgtccttgggagactac |