Skip to main content

Table 1 PCR and sequencing primers for human PNMT gene

From: Resequencing PNMTin European hypertensive and normotensive individuals: no common susceptibilily variants for hypertension and purifying selection on intron 1

Primers Sequence 5'-3'
PCR primers for the first and second gene fragments
PNMT_PCR1_F AACCCGAACCTTCTGTCCTC
PNMT_PCR1_R CAGAGTTAGACTGAACCCAGCTC
PNMT_PCR2_F GCTCAGAATTGAGAGCTAAGGTG
PNMT_PCR2_R TGTTTGTGACTTCACCTCTCTGA
Sequencing primers for the first PCR fragment
PNMT_seq1_F CTAAGTGCATTAGCACAGCTCAC
PNMT_seq1_R ATCCTCCCCACCCATTCATC
PNMT_seq2_F GTCTAAAGATTGTGGGGGTGAG
PNMT_seq2_R CTCTCCTAAGGGATGTTGCTCTT
PNMT_seq3_F ACGAGGGACAAGAGGTCGT
PNMT_seq3_R GTGGATCCTAAGGTTGGGAGTT
Sequencing primers for the second PCR fragment
PNMT_seq4_F ATAGGAGGAAATGGAGGCAGA
PNMT_seq4_R CCTGAACCAATGTCGATGAG
PNMT_seq5_F TTGCAGAGGAGAAGGAAGAACTA
PNMT_seq5_R TCAGCAGCGTGGTGATGT
PNMT_seq6_F TGCTGGCAGGATAAGGAG
PNMT_seq6_R AAAAAGCCTAGGGTGAATGTCTC