Skip to main content

Table 1 PCR primer sequences (5'→3')

From: Multiplex SNaPshot for detection of BRCA1/2 common mutations in Spanish and Spanish related breast/ovarian cancer families

Mutation (Predicted effect) PCR primers Size bp Exon
BRCA1 c.187-188delAG (p.Q23fs) F ttcgcgttgaagaagtacaaaa
R ttccctagtatgtaaggtcaattctg
151 2
BRCA1 c.330 A > G (p.64-71 del ) F ggctcttaagggcagttgtg
R cctactgtggttgcttccaa
235 5
BRCA1 c.589-590delCT (p.S157X) F ctcttcaggaggaaaagcaca
R cctgagacccttacccaattc
186 8
BRCA1 c.5236 G > C (p.G1706A)
BRCA1 c.5242 C > A (p.A1708E)
F ggacagcacttcctgattttg
R taaagggaggaggggagaaa
174 18
BRCA2 c.3036-3039delACAA (p.K936fs) F ttcatgaaacagacttgacttgtg
R ttcaaggagatgtccgatttt
208 11
BRCA2 c.5374-5377delTATG (p.Y1716fs) F tggcttagagaaggaatatttgatg
R ctggctcaataccagaatcaag
250 11
BRCA2 c.6857-6858delAA (p.E2210fs) F tgggaaaagaacaggcttca
R gaatgtgtggcatgacttgg
217 11
BRCA2 c.9254-9258del5 (p.Y3009fs) F tcttccattgcatctttctca
R ggtttgtaccggtagttgttga
209 23
BRCA2 c.9538-9539delAA (p.K3104fs) F gagtttcctttcttgcatcttaaa
R gcctgatttggattctggtc
221 25