Skip to main content


Table 1 Oligonucleotide primers used in the study.

From: Identification of novel functional sequence variants in the gene for peptidase inhibitor 3

Primer Code Sequencea Purpose PCR product (bp) Annealing temperature (°C)
01F_PI3 tgagaagggtgtgtgaaggaa PCR and sequencing 724 55
01R_PI3 accactcccagcatcaa PCR and sequencing 724 55
02F_PI3 gagttttttgcaggaccagg PCR and sequencing 717 52
02R_PI3 gaacagaaagctgaaatctg PCR and sequencing 717 50
Seq_P13_1328bp_F caagctggactgcataaaga PCR 1328 54
Seq_P13_1328bp_R cagccttcttttgtgtcttc PCR 1328 53
Seq_P13_Int1_F tgcataaagattggtatggc sequencing - 52
Seq_PI3_Int2_F tttaaaccttgggtgtggac sequencing - 54
Seq_PI3_Int3_F gaggtgtaccttccctactc sequencing - 54
-1077_A_F ctctccttgtctcAgtgtattagagtc gel shift assay - -
-1077_G_F ctctccttgtctcGgtgtattagagtc gel shift assay - -
-1067_A_ F ctcagtgtattagAgtcgtttttctca gel shift assay - -
-1067_G_F ctcagtgtattaggGtcgtttttctca gel shift assay - -
+1063_A_F gtgtattagagtcAtttttctcagaca gel shift assay - -
+1063_G_F gtgtattagagtcGtttttctcagaca gel shift assay - -
-960_T_F ggaacccccgtttTcccctttcattactt gel shift assay - -
-960_D_F ggaacccccgtttcccctttcattactt gel shift assay - -
-911_A_F gttaatagaccagaccaaAtctcacac gel shift assay - -
-911_G_F gttaatagaccagaccaaGtctcacac gel shift assay - -
-689_C_F tgtatacatgataCatgttttctacta gel shift assay - -
-689_G_F tgtatacatgataGatgttttctacta gel shift assay - -
-675_C_F atgttttctactaCtttctgattattt gel shift assay - -
-675_T_F atgttttctactaTtttctgattattt gel shift assay - -
-453_T_F ttgatgctgggagTggtaaaatgataa gel shift assay - -
-453_G_F ttgatgctgggagGggtaaaatgataa gel shift assay - -
-338_G_F gaataaccttcgGtgattcctttctcttct gel shift assay - -
-338_A_F gaataaccttcgAtgattcctttctcttct gel shift assay - -
-258_A_F taataagtgagccAgcacttctactct gel shift assay - -
-258_G_F taataagtgagccGgcacttctactct gel shift assay - -
  1. aThe nucleotide in upper case is the variant nucleotide.