Skip to main content

Table 1 Primers for amplifying LMNA for DHPLC and SSCP analysis. All sequences are listed 5' to 3'.

From: Lamin A/C truncation in dilated cardiomyopathy with conduction disease

Exon Primers
1A F:CCCAGATCCCGAGGTCCGAC
R:AGCCCTGCGTTCTCCGTTTCC
B F:ACCCGCATCACCCGGCTG
R:CCTCTCCACTCCCCGCCA
2 F:GCGGCCCGCCGCCCCCGCCGCTCCTTCTCTTAAATCTACTCTCC
R:GCGGCCCGCCGCCCCCGCCGGCTCTGAAATCAGGTGACAG
3 F:TGTTCTGTGACCCCTTTTCC
R:CCAGCCCAAGTCTGTCATC
4 F:AGCACTCAGCTCCCAGGTTA
R:CCGCCGCCCCCGCCCGGTAAGGGTAGGGCTGCCAAG
5 F:GCGGCCCGCCGCCCCCGCCGTAGCAGTGATGCCCAA
R:GCCCGCCGCCCCCGCCCGCATCCGGCCCAGACTCTA
6 F:GTCCCTCCTTCCCCATACTT
R:CCAAGTGGGGGTCTAGTCAA
7 F:GAGGTGCTGGCAGTGTCC
R:GCGGCCCGCCGCCCCCGCCGCTTGCCACTCTCTCCCTGAT
8/9 F:GCGGCCCGCCGCCCCCGCCGTGGGCCTTTG
R:TCTAGAAAGGGGCCCTGAAT
10 F:CTACCCGGAGAGCTTGACAG
R:TTCCCACTCCCTTCCTTACC
11 F:GCCCCCGCCGCCTGAGCCTTGTCTCCCTTC
R:GCGGCCCGCCGCCCCCGCCGTGCAGGATTTGGAAGACAAA
12 F:CCCCTGTTGTTCACACCTCT
R:GGGTTATTTTTCTTTGGCTTCA