Skip to main content

Table 1 Primers used for amplification of der(2) and der(8) junction fragments

From: New case of trichorinophalangeal syndrome-like phenotype with a de novo t(2;8)(p16.1;q23.3) translocation which does not disrupt the TRPS1 gene

Fragment Designation Primer sequence (5′→3′) Primer localization a Annealing T(°C) PCR size (bp)
Der(8) junction fragment AF130342-3FW CCTTCTAGAGCAAATTCTTTTAGACCTTGA chr8:116,981,340-116,981,369 62.4 632
AC007131-5FW CTCATGGTGTAGAATAGAAGCAGCAAGT chr2:59,567,411-59,567,438
Der(2) junction fragment AF130342-1RW GTTGACATCAGGACTTCAGGTAAATGAA chr8:116,981,900-116,981,927 61.4 701
AC007131-4RW AATTTCTCCTTTATTCCTCTCCCCTTTC chr2:59,568,122-59,568,149
  1. aPrimer physical localization is based on GRCh37/hg19 human genome assembly.