New case of trichorinophalangeal syndrome-like phenotype with a de novo t(2;8)(p16.1;q23.3) translocation which does not disrupt the TRPS1 gene

Table 1 Primers used for amplification of der(2) and der(8) junction fragments

Fragment	Designation	Primer sequence (5′→3′)	Primer localization ^a	Annealing T(°C)	PCR size (bp)
Der(8) junction fragment	AF130342-3FW	CCTTCTAGAGCAAATTCTTTTAGACCTTGA	chr8:116,981,340-116,981,369	62.4	632
Der(8) junction fragment	AC007131-5FW	CTCATGGTGTAGAATAGAAGCAGCAAGT	chr2:59,567,411-59,567,438	62.4	632
Der(2) junction fragment	AF130342-1RW	GTTGACATCAGGACTTCAGGTAAATGAA	chr8:116,981,900-116,981,927	61.4	701
Der(2) junction fragment	AC007131-4RW	AATTTCTCCTTTATTCCTCTCCCCTTTC	chr2:59,568,122-59,568,149	61.4	701

ISSN: 1471-2350