Skip to main content

Table 1 Sequences of primers used to amplify and sequence EGFR exons 18 to 21

From: The human epidermal growth factor receptor (EGFR) gene in European patients with advanced colorectal cancer harbors infrequent mutations in its tyrosine kinase domain

Exon Sequence 5'→3' Tm (°C)
18 for CAAATGAGCTGGCAAGTGCCGTGTC rev GAGTTTCCCAAACACTCAGTGAAAC 58
19 for GCAATATCAGCCTTAGGTGCGGCTC rev CATAGAAAGTGAACATTTAGGATGTG 67
20 for CCATGAGTACGTATTTTGAAACTC rev CATATCCCCATGGCAAACTCTTGC 58
21 for CTAACGTTCGCCAGCCATAAGTCC rev GCTGCGAGCTCACCCAGAATGTCTGG 67
  1. The annealing temperature is shown. For and rev are primers forward and reverse respectively according to the gene transcription orientation. Forward primers were used to sequence all PCR products and reverse primers to confirm the presence of mutation.
\