Association of Nrf2-encoding NFE2L2 haplotypes with Parkinson's disease

BMC Medical Genetics

Table 2 Overview of location and type of the SNPs studied

SNP	rs-ID	Genome Position	Alleles	Gene location	SNP type	TaqMan Assay
*NFE2L2*		*Chr:2(-)*
1	rs16865105	177844875	T>G	5'-region	---	C_33808341_10
2	rs7557529	177843343	G>A	5'-region	---	C__436313_10
P1	rs35652124	177838319	A>G	Promoter (-653)	Regulatory¹	Sequencing²
P2	rs6706649	177838317	G>A	Promoter (-651)	Regulatory¹	Sequencing²
P3	rs6721961	177838317	C>A	Promoter (-617)	Regulatory¹	Sequencing²
3	rs2886161	177836085	A>G	Intron 1	---	C__351881_10
4	rs1806649	177826398	G>A	Intron 1	---	C_11634983_10
5	rs2001350	177808671	A>G	Intron 1	---	C_11634985_10
6	rs10183914	177805912	G>A	Intron 3	---	C__157561_10
7	rs2706110	177800408	G>A	3'-region	---	C_11745133_10
8	rs13035806	177800068	C>T	3'-region	---	C_11745134_10
*KEAP1*		*Chr:19(-)*
1	rs1048287	10471236	T>C	Exon 2	Synonymous	C___9323068_10
2	rs11085735	10463180	G>T	Intron 3	---	Custom³
3	rs1048290	10461442	C>G	Exon 4	Synonymous	C___9323035_1_

Presented are SNPs numbered according to location on the gene. Genome positions were obtained from the HapMap Genome Browser (Phase 1 & 2 - full dataset) at the International Haplotype Mapping Project web site http://www.hapmap.org. Alleles are given according to the sense sequence of the gene. ¹[37]. ²See text for details. ³Forward primer: GCCTCCACTCCCTGAAGAC, reverse primer: GCAAGTCCCAAGACACTGAGATC, probe: TCAGGAAGAAT [C/A]CCCG, primers and probe were designed according to the anti sense strand of the gene.

ISSN: 1471-2350