Skip to main content

Table 2 Overview of location and type of the SNPs studied

From: Association of Nrf2-encoding NFE2L2 haplotypes with Parkinson's disease

SNP rs-ID Genome Position Alleles Gene location SNP type TaqMan Assay
NFE2L2   Chr:2(-)     
   1 rs16865105 177844875 T>G 5'-region --- C_33808341_10
   2 rs7557529 177843343 G>A 5'-region --- C__436313_10
   P1 rs35652124 177838319 A>G Promoter (-653) Regulatory1 Sequencing2
   P2 rs6706649 177838317 G>A Promoter (-651) Regulatory1 Sequencing2
   P3 rs6721961 177838317 C>A Promoter (-617) Regulatory1 Sequencing2
   3 rs2886161 177836085 A>G Intron 1 --- C__351881_10
   4 rs1806649 177826398 G>A Intron 1 --- C_11634983_10
   5 rs2001350 177808671 A>G Intron 1 --- C_11634985_10
   6 rs10183914 177805912 G>A Intron 3 --- C__157561_10
   7 rs2706110 177800408 G>A 3'-region --- C_11745133_10
   8 rs13035806 177800068 C>T 3'-region --- C_11745134_10
KEAP1   Chr:19(-)     
   1 rs1048287 10471236 T>C Exon 2 Synonymous C___9323068_10
   2 rs11085735 10463180 G>T Intron 3 --- Custom3
   3 rs1048290 10461442 C>G Exon 4 Synonymous C___9323035_1_
  1. Presented are SNPs numbered according to location on the gene. Genome positions were obtained from the HapMap Genome Browser (Phase 1 & 2 - full dataset) at the International Haplotype Mapping Project web site http://www.hapmap.org. Alleles are given according to the sense sequence of the gene. 1[37]. 2See text for details. 3Forward primer: GCCTCCACTCCCTGAAGAC, reverse primer: GCAAGTCCCAAGACACTGAGATC, probe: TCAGGAAGAAT [C/A]CCCG, primers and probe were designed according to the anti sense strand of the gene.