Skip to main content

Table 1 Primers selected for Exons #3 and #7 of Gene ER-β

From: Estrogen Receptor-Beta Gene Polymorphism in women with Breast Cancer at the Imam Khomeini Hospital Complex, Iran

Polymorphism site Melting temperature (°C) Oligonucleotic sequences Sequence size
Exon 3 59.23
59.86
Primers for PCR reaction
F TTGCTCCCTAGAGAGACACTGA
R CTTCACACGACCAGACTCCA
151
Exon 7 60.04
60.14
Primers for PCR reaction
F 5' GATGAGGGGAAATGCGTAGA 3'
R 5' GGCCCAGCTGTGTGATTACT 3'
156