Skip to main content

Table 1 primer sets, melting temperature (MT), PCRs size and genotyping conditions are reported for associated SNPs in GRIA1 and GRIA3 genes.

From: Common variants in the regulative regions of GRIA1 and GRIA3 receptor genes are associated with migraine susceptibility

GENE SNP PRIMERS MT SIZE ENZYME ALLELE 1 (size) ALLELE 2 (size)
GRIA1 rs548294 AGATGAAGAAACAGAGGTC 56°C 311 bp MwoI C (123/188) T (311)
   CCCCAGGTACTATTCAAAG      
GRIA1 rs2195450 TCTAAGAGGAGGGGGCAAGG 60°C 367 bp TaqI G (218/149) A (367)
   GCTTGGTAGATGGTGCTTGA      
GRIA3 rs3761555 CTGGAACAATGGAACAAAAT 55°C 272 bp BglII T (272) C (111/161)
   ATAATGCTATGTCCCTGTCT