Unannotated single nucleotide polymorphisms in the TATA box of erythropoiesis genes show in vitro positive involvements in cognitive and mental disorders

Table 3 Kinetic and thermodynamic characteristics of TBP–TATA interactions

Gene	ODN	Alleles: WT or mut	Allele	Sequences (5′ – 3′ strands), 26 bp	Prediction		Experiments
Gene	ODN	Alleles: WT or mut	Allele	Sequences (5′ – 3′ strands), 26 bp	-lnK_D	δ	-lnK_D	δ	K_D, nM	k_a, M^− 1 s^− 1	k_d, s^− 1	t_1/2, min
HbB	1 2	WT rs34500389:T	-32c > T	agggctgggcataaaagtcagggcag agggctgggTataaaagtcagggcag	19.20 20.18	+ 0.98	16.81 17.26	+ 0.45	50 ± 7 32 ± 3	(1.4 ± 0.1)10⁴ 2.1 ± 0.110⁴	(7.1 ± 0.7)10⁻⁴ (6.6 ± 0,5)10^− 4	16 ± 2 17 ± 2
HbZ	3 4	WT rs113180943:A	-29 t > A	agctccctgtatataaggggaccctg agctccctgtaAataaggggaccctg	20.76 19.28	−1.48	18.93 17.03	−1.90	6 ± 1 40 ± 20	(4.5 ± 0.4) 10⁴ (2.3 ± 0,2)10³	3.0 ± 0.6)10⁻⁴ (1.0 ± 0.4)10^− 4	38 ± 4 115 ± 15
EPOR	5	WT		cacgtcatctatttttgtctgctacg	18.24		15.59		170 ± 30	(2.8 ± 0,3)*10³	(4.6 ± 0.6)*10⁻⁴	25 ± 3
	6	rs1006576690:A	-27 t > A	cacgtcatctatAtttgtctgctacg	19.39	+ 1.15	18.33	+ 2.74	11 ± 3	(9.3 ± 0,7)*10³	(1.0 ± 0.3)*10⁻⁴	115 ± 15
	7	rs971717705:G	-29a > G	cacgtcatctGtttttgtctgctacg	18.11	−0.13	15.71	+ 0.12	150 ± 30	(2.4 ± 0,3)*10³	(3.6 ± 0.5)*10⁻⁴	32 ± 4
	8	rs567946217:A	-31c > A	cacgtacatAttttttgtctgctacg	19.33	+ 1.09	17.68	+ 2.09	21 ± 6	(6.8 ± 0.7)*10³	(1.4 ± 0.4)*10⁻⁴	82 ± 6
	9	rs567946217:G	-31c > G	cacgtсatGtatttttgtctgctacg	18.51	+ 0.27	16.34	+ 0.75	80 ± 10	(3.6 ± 0.3)*10³	(3.0 ± 0.5)*10⁻⁴	38 ± 4

ODN Oligodeoxyribonucleotide; WT Ancestral allele; mut Minor allele; K_D Equilibrium dissociation constant, which is presented as mean ± standard deviation; δ, the difference between the affinity of TBP for an ODN with and without the SNP in its TATA box expressed as natural logarithms, δ = −ln (K_D,Mut) – [−ln (K_D,WT)]; k_a and k_d, association and dissociation rate constants, respectively; t_{1/2 =} ln2/k_d, the average half-life of the TBP/ODN complexes; HBB β-globin gene; HBZ Zeta-globin gene; and EPOR Erythropoietin receptor gene

ISSN: 1471-2350