Skip to main content

Table 3 Primer sequences, PCR size and PCR-RFLP fragments using AIWNI and NIaIII restriction enzymes for MUC1 5640G > A (rs4072037) and PSCA 5057C > T (rs2294008) polymorphisms, respectively

From: Association of MUC1 5640G>A and PSCA 5057C>T polymorphisms with the risk of gastric cancer in Northern Iran

SNP Primer sequence PCR Size
(bp)
Restriction enzyme Digestion products (bp)
     Wild-type Mutant Heterozygous
MUC1 5640G > A (rs4072037) F: TAAAGACCCAACCCTATGACT 188 AIWNI 188 114,74 188,114,74
R: AGAGTACGCTGCTGGTCATACTC
PSCA 5057C > T (rs2294008 F: GAAACCCGCTGGTGTTGACT 139 NIaIII 139 101,38 139,101,38
R: GCCAAGCCTGCCATCAACAG