Skip to main content

Table 1 Primer sequences of exons of the PDE3A gene

From: Whole-exome sequencing identifies a de novo PDE3A variant causing autosomal dominant hypertension with brachydactyly type E syndrome: a case report

Primer Sequence
Exon 1-F 5′ TTCAGTGAAGAGGGCACCCTAT 3’
Exon 1-R 5′ GTCCGCACGATGGTGGC 3’
Exon 2&3-F 5′ GGAAGCGCTCGTCCAGAT 3’
Exon 2&3-R 5′ AAGGAAATGAGGGACACGGT 3’
Exon 4-F 5′ TGAATCCCGTCACTTCGCTC 3’
Exon 4-R 5′ GGTCTCTCCGTACTGGTGCA 3’
Exon 5&6-F 5′ GGAGCCTGCACCAGTACGG 3’
Exon 5&6-R 5′ GGAGCAGGGCGATGAAAGA 3’
Exon 7-F 5′ TGCCCCAGACCTATCCCCT 3’
Exon 7-R 5′ TTGGTGTCCGAGTGGCTACC 3’
Exon 8-F 5′ TGACTCCACCTGTTATATGTAGCAG 3’
Exon 8-R 5′ AGCCGATGCTTTCCTCAGAG 3’
Exon 9&10-F 5′ CTGAGGAAAGCATCGGCTT 3’
Exon 9&10-R 5′ AAAAGCTTCAAAGAGGCCC 3’
Exon 11&12-F 5′ GAAGACATGGGCCTCTTTGAAG 3’
Exon 11&12-R 5′ ATGTCCATGTGTAAATCCACTGTC 3’
Exon 13-F 5′ TTGGAGTTGATGGCGCTGTAT 3’
Exon 13-R 5′ ACAAGGAAACGGAAATGCTTAA 3’
Exon 14-F 5′ ACTTCGTAGCCAAATTTAATGG 3’
Exon 14-R 5′ GGCCTCTTCATCACCCTGT 3’
Exon 15-F 5′ TGATATCAATGGTCCAGCTAAATG 3’
Exon 15-R 5′ CCCACAATGTGAGAGATGAAGG 3’
Exon 16-F 5′ CACATTGTGGGGCCTCTGT 3’
Exon 16-R 5′ TTCTATGCCTGCCAACCGT 3’