Skip to main content

Table 2 Primer pairs used for the experimental methods

From: Novel mutations of the SRF gene in Chinese sporadic conotruncal heart defect patients

Primers Forward (5′ → 3′) Reverse (5′ → 3′)
SRF-seq TGCCAGGTAGTGTTTTCTAAGTG GGCCCCTATTCACCTTCCTT
Mut-G274D CACCAACCTGCCGGATACAACCTCCACCA TGGTGGAGGTTGTATCCGGCAGGTTGGTG
Mut-G294C GCAAGTCAGCAGCTGCCCCTCCTTTCC GGAAAGGAGGGGCAGCTGCTGACTTGC
RT-SRF ACTCTCCACCCCGTTCAGAC TGGTGCACTTGAATGGCCTG
GAPDH GAGTCAACGGATTTGGTCGT TGATTTTGGAGGGATCTCG