Skip to main content

Table 1 List of APOBEC3 primers designed; primer name, sequence and product size are indicated

From: Characterization of APOBEC3 variation in a population of HIV-1 infected individuals in northern South Africa

Name Sequence (5′-3′) Product size
A3D (12.1 kb)
 A3D Forward primer AGGAAGCCTCGCTCTCTCA 12,069 bp
 A3D Forward primer CAGGCAGGGTCTTGATCTGT
 A3D Amplicon 1F AAAAAGAGGGAGACTGGGACAAGCGTATCTAAGA 4,300 bp
 A3D Amplicon 1R GAGTGTGGGTGAGGGGGTGTAACCATGAG
 A3D Amplicon 2F AGCTAGGAGAGGTCACCCTG 3,188 bp
 A3D Amplicon 2F CAGGAGGCTAGAAGAGACAGACCATGAGGC
A3F (13.31 kb)
 A3F 1st round f ACCAGAAAGAGGGTGAGAGACTGAGGAAGATAAAG 13,142 bp
 A3F 1st round rv AGCCATTTATTGCAGAAGCTATGGATAAAGCTGGT
 A3F Amplicon 1 f ACCAGAAAGAGGGTGAGAGACTGAGGAAGATAAAG 4,918 bp
 A3F Amplicon 1 rv GGGTGAGGGGTGTAACCATG
 A3F Amplicon 2 f TTCAGAAACCCGATGGAGGC 4,478 bp
 A3F Amplicon 2 rv AGCCATTTATTGCAGAAGCTATGGATAAAGCTGGT
A3G (10.74 kb)
 A3G 1st round f TGTTAACCAGAGGCTGCTCTTCCCAGG 11,852 bp
 A3G 1st round rv TCCCTGGGACTCAGCTCC
 A3G Amplicon 1 f ATTTGTCCCCAGCTCTGTGG 3,231 bp
 A3G Amplicon 1 rv AGAGGACCTGGTCTGGAACA
 A3G Amplicon 2 f CAAGGGAGGAAGCGTGGAG 3,908 bp
 A3G Amplicon 2 rv TGCATTGCTTTGCTGGTGTC
A3H (6.8 kb)
 APOBEC3 H forward primer full length TCTGTTGCACAGAAACACGATGG 3522bp
 APOBEC3 H reverse primer full length CAACTGACATGCCCCAGGG
 APOBEC3 H forward primer Exon2 (A3HfE2) TCTGTTGCACAGAAACACGATGG 452bp
 APOBEC3 H Reverse primer Exon 2(A3HrE2) TTCCCGAAGTAGTGACTGAGC
 APOBEC3 H forward primer Exon 3 &4(A3HfE3/4 GCCACGCACTAGAAAGTTCAC 934bp
 APOBEC3 H Reverse primer Exon 3&4(A3HrE3/4) ACAGTGCCTCACCTTTATCC