Skip to main content

Table 1 List of the germline and somatic genomic alterations in these genetic tests

From: Response to olaparib in metastatic castration-resistant prostate cancer with germline BRCA2 mutation: a case report

Type Gene Start End Ref Alt Function NC change AA change AF
First genetic test
 Germline BRCA2 chr13:32913773 chr13:32913773 G T stop-gained c.G5281T p.G1761X N/A
 Mutant PIK3CA chr3:178936094 chr3:178936094 C A missense-variant c.C1636A p.Q546K 17%
Second genetic test
 Germline BRCA2 chr13:32913773 chr13:32913773 G T stop-gained c.G5281T p.G1761X N/A
 Mutant PIK3CA chr3:178936094 chr3:178936094 C A missense-variant c.C1636A p.Q546K 0.4%
Third genetic test
 Germline BRCA2 chr13:32913773 chr13:32913773 G T stop-gained c.G5281T p.G1761X N/A
 Mutant PIK3CA chr3:178936094 chr3:178936094 C A missense-variant c.C1636A p.Q546K 19.9%
 Mutant NKX2–1 chr14:36987087 chr14:36987087 G A missense-variant c.C512T p.A171V 7.1%
 Mutant ERBB4 chr2:212587159 chr2:212587159 G C missense-variant c.C842G p.A281G 19.6%
 Mutant RUNX1 chr21:36164438 chr21:36164467 GGGCCTCCACACGGCCTCCTCCAGGCGCGC inframe-deletion c.1408_1437delGCGCGCCTGGAGGAGGCCGTGTGGAGGCCC p.470-479del 17.6%
 Mutant NF1 chr17:29496949 chr17:29496949 G A missense-variant c.G520A p.V174I 16.6%
 Mutant MET chr7:116412084 chr7:116412084 T C intron-variant c.T3082 + 41C N/A 6.1%
 Mutant FGFR4 chr5:176520737 chr5:176520737 C A missense-variant c.C1480A p.P494T 1.5%
 Mutant TET2 chr4:106157937 chr4:106157937 T frameshift-variant c.2838delT p.T946 fs 0.2%
 Mutant TET2 chr4:106157939 chr4:106157939 A C missense-variant c.A2840C p.Q947P 0.2%
  1. chr chromosome, Ref reference, Alt alternative, N/A not applicable, NC change nucleotide change, AA change amino acid change, AF allele frequency