Skip to main content

Table 1 Primers sequences and the expected product size

From: The effect of ERCC1 and ERCC2 gene polymorphysims on response to cisplatin based therapy in osteosarcoma patients

Gene of interest Forward & reverse primers Expected product size Annealing T
ERCC1 C118T F:5’GCAGAGCTCACCTGAGGAAC3’ 208 bp (Won et al., 2010) 65 °C 1 min
R:5’GAGGTGCAAGAAGAGGTGGA3’
ERCC1 C8092A F:5’CAGAGACAGTGCCCCAAGAG3’ 161 bp (Zhou et al., 2004) 63 °C 45 s
R:5’GGGCACCTTCAGCTTTCTTT3’
ERCC2 G312A F:5’CAGCTCATCTCTCCGCAGGATCAA3’ 165 bp (Mechanic et al., 2005) 61 °C 45 s
R:5’GTCGGGGCTCACCCTGCAGCACTTCCT3’
ERCC2 A751C F:5’TCAAACATCCTGTCCCTACT3’ 344 bp (Sturgis et al., 2000) 60 °C 35 s
R:5’CTGCGATTAAAGGCTGTGGA3’