Fig. 4

Sequence analysis of OPA1 transcripts. Sequencing of an additional larger transcript species found in the index patient (III:1) identified an activation of a cryptic acceptor splice site leading to the retention of intronic sequence containing an insertion of 22 bp c.611-37_611-38ACTGGAGAATGTAAAGGGCTTT (blue boxes) flanked by intronic sequence (light gray). Red boxes represent the deletion c.611-6_611-16CATATTTATCT. Intronic sequence is written with small letters and exonic sequence with capital letters. (*) indicates the activation of the cryptic splice site, which is located in the wildtype sequence, 166 bp upstream of the canonical splice site. This transcript species was also identified and sequenced in the affected family members (I:2 and II:2) (sequence data not shown)