Skip to main content

Table 3 Primers designed by oligo 7

From: A novel, complex RUNX2 gene mutation causes cleidocranial dysplasia

Name Forward nucleotide sequence (5′-3′) Reverse nucleotide sequence (5′-3′)
RUNX2 ATGGCATCAAACAGCCTCTTC TCAATATGGTCGCCAAACAGA