Skip to main content

Table 2 Primers used for qRT-PCR

From: A novel, complex RUNX2 gene mutation causes cleidocranial dysplasia

Positions Forward nucleotide sequence (5′-3′) Reverse nucleotide sequence (5′-3′)
q-RUNX2 TCCTCCCCAAGTAGCTACCT GAGGCGGTCAGAGAACAAAC