Skip to main content

Table 1 Primers used in RUNX2polymerase chain reaction (PCR)

From: A novel, complex RUNX2 gene mutation causes cleidocranial dysplasia

Positions Forward nucleotide sequence (5′-3′) Reverse nucleotide sequence (5′-3′)
Exon 1 AGAGAGAGAAAGAGCAAGGGG GCATAGACTGTGGTTAGAGAGC
Exon 2 TTTCTTTGCTTTTCACATGTTACC TGCTATTTGGAAAAGCTAGCAG
Exon 3 CGCTAACTTGTGGCTGTTGT CGTGGGCAGGAAGACACC
Exon 4 CATTCCTGTCGGCCATTACTG CATCAAAGGAGCCTAATGTGCT
Exon 5 AAGTGGTCATCGGAGGGTTT TGCAGATAGCAAAGTCCACAA
Exon 6 GGCCACCAGATACCGCTTAT CCAGCGTCTATGCAAGTGAA
Exon 7 GCCTGAAAGGATGGGGTTAT CTGTGCAGGGATGGATTTTT
Exon 8 CTTATGGGCCTGCAGACTCT AGTAACAACCAGACAGCCCA
Exon 9 CTGTGGCTTGCTGTTCCTTT TGATACGTGTGGGATGTGGC