Skip to main content

Table 1 Mutagenic oligos (Round 1 PCR) used for site directed mutagenesis in exon 8 and 9 of the WT1 gene

From: Screening of WT1 mutations in exon 8 and 9 in children with steroid resistant nephrotic syndrome from a single centre and establishment of a rapid screening assay using high-resolution melting analysis in a clinical setting

Mutation Oligo Name Oligo sequence 5’–3’ Annealing temperature (°C)
Exon 8
c.1079G > A;C360Y (hg19 - c.1283G > A; C428Y)
WT1_E8_F _A
E8_C428Y_R_C
TTCCCCAAGGTGAGAAACCA
ACCTTCGTTCATAGTCCTTGAAG
56
E8_C428Y_F_ B
WT1_E8_R_D
CTTCAAGGACTATGAACGAAGGT
GCTGCCAGCAATGAGAAGTG
58
Exon 8
c.1119C > A;H373Q (hg19 - c.1323C > A;H441Q)
WT1_E8_F _A
E8_H441Q_R_C
TTCCCCAAGGTGAGAAACCA
TGTCTCCTTTGTTGTCTTTTGAG
58
E8_ H441Q _F_ B
WT1_E8_R_D
CTCAAAAGACAACAAAGGAGACA
GCTGCCAGCAATGAGAAGTG
58
Exon 9
c.1180C > T;R394W (hg19 - c.1384C > T;R462W)
WT1_E9_F_A
E9_R462W_R_C
TTGTTAGGGCCGAGGCTAGA
TGGTCGGACCAGGAGAAC
56
E9_R462W_F _B
WT1_E9_R _D
GTTCTCCTGGTCCGACCA
AGTGCGTAAACTTTTCTTCACAT
60
Exon 9
c.1190A > C;H397P (hg19 - c.1394A > C; H465P)
WT1_E9_F_A
E9_ H465P_R_C
TTGTTAGGGCCGAGGCTAGA
GTCTTCAGGGGGTCGGACC
60
E9_ H465_F_B
WT1_E9_R _D
GGTCCGACCCCCTGAAGAC
AGTGCGTAAACTTTTCTTCACAT
52
Exon 9
c.A1200C > T;H401Y (hg19 - c.1405C > T;H469Y)
WT1_E9_F_A
E9_ H469Y_R_C
TTGTTAGGGCCGAGGCTAGA
GTCCTGGTGTGAGTCTTCAGGTG
58
E9_ H469Y_F_B
WT1_E9_R _D
CACCTGAAGACTCACACCAGGAC
AGTGCGTAAACTTTTCTTCACAT
56
  1. Oligos in bold indicate mutagenic oligos