Skip to main content

Table 1 Primers used for PCR, sequencing, and multiplex PCR for PHKA2 mutation analysis

From: PHKA2 mutation spectrum in Korean patients with glycogen storage disease type IX: prevalence of deletion mutations

Exon Forward primer sequence Reverse primer sequence Product size (bp)
PHKA2   
1 CCATCCCAAGAACCGACTAA GCAACAGTTAGGTCCCCTGA 395
2 AGGTCCCGGTCCTCATCTAC GAGAGGCCTACACCCAAACA 367
3 AGCCACAGTGATCAGGAGGT AATGACATGGAATGCCCACT 174
4 GCTGGGACATTTTAGGCAAG CACATGGCCTGACACACTG 467
5 CCTTCCCTCTTTTCGGAGAT GCAGTTTGTGTGTGGAGGTG 419
6 GGCTGCAGGAACATAAAGGA CCAGGACGGAGCACTCTTAC 401
7 TTGCTTAATGAAAAAGGAACACC CTAGCTTGTGAGGCCAGAGG 349
8 TGACTTCTCGCCTGAGGAAT ACCTCATGGGGAACTGAGG 427
9 TATCTGCCTTGGTGGCTTTT CCAGCTCACCGTCCCTACTA 434
10 TCAGTCAAGCATGGGAAACC CTCTGCCCAAATTGCAGAAT 414
11 CCGATCGTGTTTAGCTCCTC TCCCAAAGTGCTGGGATTAC 475
12 ATTGGCCTGGAGGATGAGTA TGGACACACAAGGCTGAGAG 399
13 TGAATATGTTGAGCCCCAAA CCCAGTTGCAATCAAGGTT 428
14 ATGTCACCAGGCAGAAGAGG CCGCCTGCTTTAGTTTTTGT 353
15 GAAGAACCAAGCCCCAAAAT ACGCCTGTCTCAAAAAGCAT 421
16 ACTGGGTGGATTGAAACGAG AGAAGCCCCTTCAGTGCTTA 389
17 CGGGAATCTTCTATGCCAGA TGGTTCACCTCCCTATGTCC 444
18 CCACATGGTTGTGCAAAAGT CGGTTTTTAAACGGGCATT 441
19 GCTTGCTACCCATGGTCACT GGGGCATTTTGTTGTCTTCT 364
20 GAGGCAAAGGTTGCAGTGAG TGCAAGTCAGATTCCAGACAA 412
21 GAAAACTGGAGCACAGCACA CCATGTCAGGATGCAATGAG 434
22 ACCACGTCCTGATGTTAGGC ATGGGGCTCCTTCACAAGTA 449
23 TCCCTGTCTGGGTTGCTTAG AGACGCATCCATGTGACAGA 382
24 TCTGTCACATGGATGCGTCT TCTCCTGAGGCAGACACACA 303
25 ACAGCCTTCCTCAGAGTGGA GGATGCTGGGTTCGAGATAA 321
26 TTTCAGCCCCAAAGCAATAG ACACTGCGAGCAAGTCTCAA 435
27 CAGAGAAGGCCCTCATTGTC GGACAGGGGTGTGTTCAGAT 376
28 CCATGAGAAATGCACTCGAA ATAGAGCCGCCCTCTACACA 337
29 CTCTGCTGCTGCTTTCTGTG GACGGAGAACAAAGCTCAGG 365
30 GTGGTGTTCTGGCATTTGTG ATCCTCAGGGCTGTGTGTTT 383
31 TGTTCCATCGAAAACACAGC TGATGCCAATAAATGCTGGA 436
32 GCTACGGTCACCCTTGGTTA TTTTTCCCCATCATCTGTGA 410
33 CTCAGAAGGCCAAGGCTCTA CTGATGGGACATGCTTTCCT 415
MECP2 a   
4 CGCTCTGCCCTATCTCTGAC TCCCCTCGGTGTTTGTACTT 1061
  1. aUsed as amplification control of MECP2 gene exon 4 located in Xq28 for multiplex PCR