Skip to main content

Advertisement

Springer Nature is making SARS-CoV-2 and COVID-19 research free. View research | View latest news | Sign up for updates

Table 2 Internal SNaPshot® primers for the analysis of 8 BRCA recurrent mutations

From: Tracking of the origin of recurrent mutations of the BRCA1 and BRCA2 genes in the North-East of Italy and improved mutation analysis strategy

GENE Mutation Primer name Sequence Orientationa Size ddNTP wt/mut Signal colour
BRCA1 c.116G > A 1snap116-S AAAAAAAAACAAGGAACCTGTCTCCACAAAGT S 32 G/A Blue/Green
BRCA1 c.181T > G 1snap181-S AACAGAAGAAAGGGCCTTCACAG S 23 T/G Red/Blue
BRCA1 c.676delT 1snap676-AS AAAAAAAAAGTTACATCCGTCTCAGAAAATTCACA AS 35 A/G Green/Blue
BRCA1 c.1687C > T 1snap1687-AS AAAAAAAAAAAAACTATTGGGTTAGGATTTTTCTCATTCT AS 40 G/A Blue/Green
BRCA1 c.5266dupC 1snap5266-S AAAGCGAGCAAGAGAATCCC S 20 A/C Green/Black
BRCA2 c.5682C > G 2snap5682-S AAAAAAAACGAAAATTATGGCAGGTTGTTA S 30 C/G Black/Blue
BRCA2 c.7806-2A > G 2snap7806-AS TGGAGTGTCACACAGAGCCC AS 20 T/C Red/Black
BRCA2 c.8878C > T 2snap8878-AS GTTGTGACATCCCTTGATAAACCTT AS 25 G/A Blue/Green
  1. aS sense, AS antisense