Skip to main content

Advertisement

Table 1 Primers used for the GRACE-PCR alpha globin copy number assay

From: Development and validation of a high throughput, closed tube method for the determination of haemoglobin alpha gene (HBA1 and HBA2) numbers by gene ratio assay copy enumeration-PCR (GRACE-PCR)

Primer Direction Primer Sequence 5′-3′ Target Gene symbol Primer Concentration (μM) Product size (bp) Product Tm (°C) Position on Ref Sequence NC_000016.10
Forward CACCCGGCCTCATGGAT CLCN7 0.16 155 79.4 1,462,101 to 1,462,255
Reverse AAGAGAACTACAGACCAACACCC
Forward CCATCTTTACGTTTCTGGGCACTC HBA1 0.45 131 82.2 177,800 to 177,930
Reverse GCCATGCTGGAGTGGGACTTC
Forward CCGTTAAGCTGGAGCCTCGGT*A HBA2 0.45 171 85.2 173,594 to 173,764
Reverse ACACCTCCATTGTTGGCACAT
  1. *indicates the use of phosphorothioate (PTO) to block 3′ exonuclease activity