Skip to main content

Table 1 Primers and probes of the 5 ADRB2 SNPs

From: β2-Adrenergic receptor promoter haplotype influences the severity of acute viral respiratory tract infection during infancy: a prospective cohort study

Loci rs number Primers Probes
−2387 rs1432623 Forward Primer Vic- TCACACAAGTATAGTTTG
5′-TTCTAAACCACTAAGTAATTTATGTAAACTTCGCTT-3′
Reverse Primer Fam- CACACAAGTGTAGTTTG
5′-GGTAAGCAAGAATTGAATGATATAGTAAGAAATATGAAAA-3′
−2274 rs11168068 Forward Primer Vic- AATCACGAAGTACCTGATTT
5′-GGAAGTGACTTTATGCCCCTTTAGA-3′ Fam- TCACGAAGTACCTAATTT
Reverse Primer
5′-AGATTCACCAAACTTGGAGCTTTCT-3′
−1343 rs2400707 Forward Primer Vic-TTCACATGGCACAACC
5′-TAAGTCACAG ACGCCAGATGGT-3′ Fam- CACATGGCGCAACC
Reverse Primer
5′-AACAAA CTATCCAGCA GATGAAAGGA T-3′
+16 rs1042713 Forward Primer Vic- CAC CCAATGGAAGCC
5′- CGGCAGCGCCTTCTTGCTGGCAC-3′ Fam-CAC CCAATAGAAGCC
Reverse Primer
5′-TGCGTGACGTCGTGGTC-3′
+27 rs1042714 Forward Primer Vic- TCGTCCCTTTGCTGCGT
5′-CCTTCTTGCTGGCACCCAAT-3′ Fam-TCGTCCCTTTCCTGCGT
Reverse Primer
5′-TGCCCACCACCCACAC-3′