Skip to main content

Table 3 EvaGreen primer sequences

From: Mapping the deletion endpoints in individuals with 22q11.2 Deletion Syndrome by droplet digital PCR

Gene Forward primer Reverse primer
DGCR8 5'- ATGTGTTCCTTCTGCTCTGAT- 3' 5'- CTTACTACAGAGGAAGCATGAAG - 3'
TRMT2A 5'- TTTTGCTCACCCTTCCTGTT- 3' 5'- CTGGCAGTCAAACAAGAGGA- 3'
RANBP1 5'- GAGTGCAGCAGTGGTATCAT- 3' 5'- GATGGCTAACACCCGTAGTC- 3'
ZDHHC8 5'- CTTTCATGGACCCTGGTGTT- 3' 5'- TCCCTAAGGCTGTCTCAAGT- 3'
LOC284865 5'- GCCTTGACCTCTGTTTCTGT- 3' 5'- CCCAAGAAGAAAGAGGCACA- 3'
RTN4R 5'- TGATGTGAGAAGGTCCTCCA- 3' 5'- CTGCTTCCCTCAGTTGGAAA- 3'
DGCR6L 5'- AGTGTTCGGAAGAGGTCTCT- 3' 5'- AACAAAACTGGTTGGACCCA- 3'
SCARF2 5'- TAGGGCCAGTCTATCCCATC- 3' 5'- TTCACAAGCAGGCTTGGATT- 3'
SHGC-2421 5'- TCATGTGGGTGCTGGTAC- 3' 5'- TCCTTGCACCAGGCAAC - 3'
HIC2 5'- GAGTCCCTCAGAGAATGGC- 3' 5'- GCCCTGTGGAAGCCTG- 3'