Skip to main content

Table 2 TaqMan primer sequences

From: Mapping the deletion endpoints in individuals with 22q11.2 Deletion Syndrome by droplet digital PCR

Gene Forward primer Reverse primer
D22S182 5'- CAGCTCCCAAGTCTTTCCAGC -3' 5'- CCAGGGTAGGAAACAGGTCGA -3'
PRODH 5'- GGGAAAGGAGAGTTCAGGCAG -3' 5'- GCTTGTTGAATAGCCTCTGTCCTAG -3'
TUPLE1 5'- GGCAAGTGCAATATTCATGTGGT -3' 5'- TCCTACACGCCTGACAAAGCT -3'
COMT 5'- GTGCTACTGGCTGACAACGTGAT -3' 5'- GGAACGATTGGTAGTGTGTGCA -3'
ZNF74 5'- TGGCCTCCTGCTTCTTTCTTC -3' 5'- CAGACACTCCAATTCATGACGAA -3'
PIK4C4 5'- ATGCTTGTGCGACGCAGAC -3' 5'- CCTCAGCCATGTTGACTCAGC -3'
D22S936 5'- TGGCAGCCAGTTTAGTATTCTGC -3' 5'- TTGTAATCAAGTCCCGCCACT -3'
VPREB1 5'- CGACCATGACATCGGTGTGT -3' 5'- CTGGCTCTTGTCTGATTGTGAGA -3'