Skip to main content

Table 2 Primers and conditions used for PPOX gene and cDNA amplification

From: Genetic and biochemical studies in Argentinean patients with variegate porphyria

  Amplified region (exon) Amplified Region (intron) MW (pb) Sequence (5' to 3') Annealing (°C) Mg+2 (mM)
I 2, 3, 4 2, 3 758 F: GCTTCTGGAGCGCAGGTTGTCC
R: AAGGCATATGAGGATGAGGGCA
60 1.6
II 5, 6 5 680 F: AGGTATGTCAGGAGCTTCCCCC
R: CCCTCACTTTGGCAGTACTTAA
60 1.6
III 7, 8 7 852 F: TGCTGGGATTACAGGTGT
R: AGCTTTTGCTTCTCACTGGTAGG
62 2.5
IV 9 ----------- 321 F: GATTACAGGTGTGAGCCACCA
R: CCTACCAGTGAGAAGCAAAAGCT
60 2
V 10, 11,12, 13 10,11,12 13 859 F: GCCCTTTCCTTCTGACGCATG
R: GCCAGACCAAGCCAAGCCAAGC
62 2.5
VI 1 1 440 F: CCAAGTCCCGCCAATCCAGAT
R: GGACAACCTGCGCTCCAGAAGC
60 5
VII Promotor ----------- 705 F: AGGTGATAGAGAACTGGCCCAA
R: CAGCCTTTTCGGTCTCTCCTA
63 3
VIII ------------ 4 786 F: TCTGAGCTTGGCTTGGATTC
R: CTCTGCAGCTGGTTTAGG
60 2
IX ------------ 6 528 F: GCTTTCCCAGTCTCTTCC
R: AAGGCCTGGCGAATGAGT
60 2
X ------------ 8 313 F: ATTCTCATTTTCTGGGTCTCTC
R: TCAGCAGGGAGCAGCTCACTG
60 2
XI ------------ 9 535 F: CTGAGTGCCATCACTGCA
R: GCTCAGGGAAAGCAACTG
60 2
XII Gen All 5,500 F: AGAGAACTGGCCCAAAATTGGAGT
R: CAGACCAAGCCAAGCCAAGCAATT
60 2
4–9 From nt 226 (exon 4) to nt 893 (exon 9). 668 F: TCTGAGCTTGGCTTGGATTC
R: GTCACTCGACGAGGGACGACT
60 3
6–9 From nt 478 (exon 6) to nt 893 (exon 9). 416 F: TCTCTAGCCATGGACAGTCT
R: GTCACTCGACGAGGGACGACT
60 6
  1. All primers were developed in the course of this study. Primers I to XII were used for DNA amplification and primers 4–9 and 6–9 were used for cDNA amplification.