Skip to main content

Table 2 Redesigned primer pairs for HRM

From: Mutation spectrum of 122 hemophilia A families from Taiwanese population by LD-PCR, DHPLC, multiplex PCR and evaluating the clinical application of HRM

Exon Oligo (5' – 3') product size
HA – 1-1F CCACTGATAAAAAGGAAGCA 226
HA – 1-1R GTGGAGAGCTCTATTTGCAT  
HA – 1-2F CCTCCTGGGAGCTAAAGATA 248
HA – 1-2R CGATCAGACCCTACAGGA  
HA – 4-1F CTTTGAGTGTACAGTGGATATAGAA 200
HA – 4-1R AAAGATATGAGTAGGTAAGGCACA  
HA – 4-2F TGATAAAGTCTTCCCTGGTG 209
HA – 4-2R TGCTTATTTCATCTCAATCCT  
HA – 7-1F CCTAGCAAGTGTTTTCCATT 246
HA – 7-1R AGGTCCATCAAGAGTGTTTG  
HA – 7-2F GCCACAGGAAATCAGTCTAT 236
HA – 7-2R TTCATTTTAAAGATCCAAGA  
HA – 8-1F TGAGCCAATTCAATCTCTTT 237
HA – 8-1R ATCATCAAACCTGACCACAT  
HA – 8-2F TAATGAAGAAGCGGAAGACT 245
HA – 8-2R TTTTGAGTATGGGGAAGAGA  
HA – 9F CCCAACCTCTCATCTTTTT 250
HA – 9R CCAGACTTTTTCTTCTTACCTG  
HA – 11-1F CAGATTTGTAGAACCCTTGC 216
HA – 11-1R TAGAGTAATAGCGGGTCAGG  
HA – 11-2F CTGCCAGGAGAAATATTCAA 239
HA – 11-2R AAGGGGACATACACTGAGAA  
HA – 13-1F CATGACAATCACAATCCAAA 244
HA – 13-1R AGAATGGGAATAGGGTGAGT  
HA – 13-2F GAGGTGGCATACTGGTACAT 219
HA – 13-2R ATACGAATGGCTAGTGAAGC  
HA – 14-1F CTGTGTTATGAGTAACCAGAGT 243
HA – 14-1R CCTAGTGCTAGGGTGTCTTG  
HA – 14-2F AATGCCATTGAACCAAGA 238
HA – 14-2R CATATTTGGCTTCTTGGAGA  
HA – 14-3F TCTTGCGACAGAGTCCTACT 242
HA – 14-3R TTTCTTCAACTCTGTTGCTG  
HA – 14-4F TCAGGCCTCCAATTAAGAT 250
HA – 14-4R GGTCCACCAGACTCAGTAAG  
HA – 14-5F AGA TAC CAC TCT ATT TGG CA 229
HA – 14-5R AAC TTT GAA TAA GGC ATT A  
HA – 14-6F TGGTAGGTTATTTAAAGGGAAA 248
HA – 14-6R GCATTCTGTCATGAATCAAA  
HA – 14-7F CCATCAGTCTGGCAAAATA 250
HA – 14-7R ATCCACCTTGCTGATTCTG  
HA – 14-8F CACAAAATCCAGATATGTCGT 235
HA – 14-8R CCATCTCTTTGAGTCCTACG  
HA – 14-9F AGGAAAGGGTGAATTTACAA 249
HA – 14-9R TTTTGCCTAGTGCTCAGTAA  
HA – 14-10F TTGCCTCAGATACATACAGTG 250
HA – 14-10R TGCATGCATATTTCTCTACAA  
HA – 14-11F AAAACTTGGAAGGCTTGG 250
HA – 14-11R TTGTAGTCTATCTGTGTGAGG  
HA – 14-12F GGTCCAAAAACATGAAACAT 245
HA – 14-12R ATAAGATGCTGCTGGAAGAT  
HA – 14-13F GGTCCTATTCCAAGACAACTC 250
HA – 14-13R AGATGTTTTGGGCAAGTCT  
HA – 14-14F CACATACAAGAAAGTTGAGAACA 250
HA – 14-14R GCTTTCTGTTGCTACTCTCAG  
HA – 14-15F TGGAATGAAGCAAACAGAC 250
HA – 14-15R TTTGTCCCTCATTTATTGCT  
HA – 14-16F ATACCATTTTGTCCCTGAAC 249
HA – 14-16R TGTCAAAATCTTCCTTCTTCA  
HA – 14-17F TTCAGTCAGATCAAGAGGAAA 246
HA – 14-17R TCAAATGTCACAAGAGCAGA  
HA – 15F TATTGCTTTTCCTCTGCTTT 214
HA – 15R TTTCTTGTAATTCCACTGTCC  
HA – 16-1F GGGATGTAAACCCTAAGGAC 228
HA – 16-1R ATGATGTTGCACTTTCCAA  
HA – 16-2F CTCTCGTCCCTATTCCTTCT 232
HA – 16-2R TAAACCAAAAAGTGGTCAGC  
HA – 17-1F ACTCATAGGATTGATGTCTTCC 238
HA – 17-1R TAAAAGTGGGATCTTCCATC  
HA – 17-2F CTAACACACTGAACCCTGCT 241
HA – 17-2R TCATTTGTCAAAGTGCAATC  
HA – 18F TTTTAACAGGCTTCTCTGTG 246
HA – 18R AGGTAGAAGAAAGAGCACAAAC  
HA – 19F AAATAATTTCTGTTCCTGTTG 222
HA – 19R ATTCCAGAAAGGAAGAAAGC  
HA – 25-1F GGT GAC CAA GAG GCT AC 170
HA – 25-1R GAC TGC TGG AGA TGA GGA  
HA – 25-2F CAG GGA GTA AAA TCT CTG C 155
HA – 25-2R TGG TAT TTT TTT TCT TTC TT  
HA – 26-1F AGAAGTGAGAAAAGCGTCTG 244
HA – 26-1R ACCCTCAGTAGAGGTCCTG  
HA – 26-2F GAATTCACCCCCAGAGTT 234
HA – 26-2R AGAAATGCAGGACTGATGAT  
  1. Some of the primers used for HRM were redesigned by LightCycler Probe Design Software 2.0. The primers not listed were the same with table 1