Skip to main content

Table 5 PCR Conditions

From: The NEI/NCBI dbGAP database: Genotypes and haplotypes that may specifically predispose to risk of neovascular age-related macular degeneration

SNPs Gene Location Variant Forward primer Reverse Primer
rs11575221 ? ? A/C TCTCCAGGCTCCTCAAGCTA CGCCTACAACTTCGGCTAAC
rs949252 GPR152 Exon 01 T/C CAGCCACAGCTGAACCCTAC TCTGACTGGCTGGTTCCTCT
rs11194995 ADD3 Intron 12 C/T TCAAGAGTGTTTTCTTCCCATTT ATTAGTCGGGCACGGTGA
rs6656448 ZBTB41 Intron 02 G/A ATTAACACGCCTCCAACCAC CAACAGTGTTTGGGCTGAGA
rs12677 ASPM 3' UTR C/T GGGAAATGATGTGTTCAGGAG AGGTGTAATCAGCTATTATTTCCTTT
rs6003 F13B Exon 10 G/A TCCAAAATGAAATCGCCAAT GGTGGGTTGTAGGGATTGAG
  1. Abbreviations: PCR, Polymerase Chain Reaction; SNP, Single Nucleotide Polymorphism.