Skip to main content

Table 1 Details of STS markers linked to the WNT7A gene used in this study

From: Variation in WNT7A is unlikely to be a cause of familial Congenital Talipes Equinovarus

Marker Primer sequence Gen Map* (cM) Physical location (bp)**
D3S2403 F: ACAGATTGAGACCATGTGTCA
R: CACACTCAAAATACATGAAGGC
37.20 13,147,397–13,147,709
D3S2385 F: GCTGTATTCGGGAGCATCTA
R: CCACCATGAAAGAATGGCTA
38.54 13,853,945–13,854,287
WNT 7A    13,835,083–13,896,619
D3S1252 F: TGTGGCCACTGAACTCTCTG
R: TCCAAGTGTTGAGAGCATGC
38.83 13,916,603–13,916,877
  1. * Genetic map positions from Marshfield [27].
  2. ** Physical locations obtained through UCSC genome browser.