Skip to main content

Advertisement

Table 1 Primer sequences and PCR conditions for LOXL1 sequencing

From: DNA sequence variants in the LOXL1 gene are associated with pseudoexfoliation glaucoma in a U.S. clinic-based population with broad ethnic diversity

Exon Primer Sequence MgCl2 (mM) Annealing Temperature (°C) Amplicon (bp)
1A F: TCCCAGCCTGTTGCTTATTC 1.5 55 326
  R: AGGCCTGGTGGACAGAGAG    
1B F: AAGCAAGGAGCCTTCCTGTC 1.5 55 260
  R: GTACACCTGCCCGTTGTTCT    
1C* F: GCAGGTGTACAGCTTGCTCA 1.5 55 464
  R: ACACGAAACCCTGGTCGTAG    
1D F: CTCCTACCCGCAGCAGTTC 1.5 55 227
  R: GGTACTCGGGCAGCTCTTC    
1E F: CGACCAGGGTTTCGTGTACT 1.5 55 280
  R: AGGGTAGGCCTGCTCGAAG    
1F F: AGCAGGCCTACCCTGACC 1.5 55 340
  R: GCCTCCAGGAAGTTCTAAGGA    
2 F: GGAGGTCTCTGGGCATTAGC 1.5 58 354
  R: TCACTGATGAAACGGTCAGG    
3 F: TCTTCAGGGACAAGGAGTGG 1.5 58 357
  R: AGTGCTCATGGTGGGAGG    
4 F: CAGGGAAGACTAGGCCCTCT 1.5 58 324
  R: CTGTGAGCAGAGCTGAGTGG    
5 F: GAAACAAGCAGCATCACAGC 1.5 58 220
  R: GGCTGAAGCTTCTTTCAGGA    
6 F: TCTGGTGAGCAGTTGAGGTG 1.5 58 202
  R: GGTGGGCAAACTCTTACTGG    
7 F: CCCTCATTGACCCACTGTCT 1.5 58 356
  R: GCATGCAGAGCCACAGAGTA    
  1. Note.-F: forward; R: reverse.
  2. *The SNP rs1048661 is located in exon 1 and was analyzed in this amplicon.