Skip to main content

Table 2 BHD/FSP mutations genotyped in Boston early-onset COPD study probands

From: Folliculin mutations are not associated with severe COPD

Name Location Effect Disease Sequence
c.235_238delTCGG [8] Exon 4 Frame shift FSP GCAGCCCGGGGCCCAAAAAG [TCGG/-] ACATGTGCGAGGCAAGTGTC
c.630_631delAGinsC [1, 9] Exon 7 Frame shift BHD GCATTTCAGGTGTTTGAGGC [AG/C]AGCAGTTTGGATGCCCACAG
c.923_950dup28bp [1, 9] Exon 9 Frame shift BHD CTCTGAGGCTGAAGAGGAGG [AGAAAGCCCCTGTGTTGCCAGAGAGTAC/++]AGAAAGCCCCTGTGTTGCCA
c.943G>T [7] Exon 9 p.Glu315X FSP AGAAAGCCCCTGTGTTGCCA [G/T]AGAGTACAGAAGGGCGGGAG
c.1278insC [1, 9, 21, 12, 11, 10, 13, 46] Exon 11 Frame shift BHD GCACGTGCAGATCCCCCCCC [-/C] ACGTGCTCTCCTCAGGTGCG
c.1278delC [1, 9, 21] Exon 11 Frame shift BHD CGCACGTGCAGATCCCCCCC [C/-] ACGTGCTCTCCTCAGGTGCG
c.1429C>T [7, 9] Exon 12 p.Arg477X FSP/BHD GGAGCCCTGTAGCTGCAGAC [C/T] GAGGTGGGTGCCCCCAGGCA
  1. FSP = Familial Spontaneous Pneumothorax; BHD = Birt-Hogg-Dubé. Positions with reference to RefSeq accession number NM_144997. Nucleotide numbering uses the A of the ATG translation initiation start site as nucleotide +1.