Table 2 Splice site prediction with NNSplice 0.9 and NetGene2 v. 2.4. AY604046.1
NNSplice 0.9 | ||||
|---|---|---|---|---|
Acceptor site predictions: | ||||
Start | End | Sequence (5'-> 3') | Function | |
80131 | 80150 | tatgttttaggcatcctgga | Exon 2 acceptor | |
85469 | 85488 | tcctttgca gaaagaattta | Exon 2 acceptor | |
Alternative acceptor sites: | ||||
Start | End | Sequence (5'-> 3') | Localization | Effect on FGF10 transcript |
81353 | 81372 | tccctcccagagacagatca | Intron 2 | insertion of 4116 bp |
81899 | 81918 | ctaatatcaggtccactttt | Intron 2 | insertion of 3570 bp |
82609 | 82628 | ctcccaatagattgtgacct | Intron 2 | insertion of 2860 bp |
84430 | 84449 | ctatttttagtatagacggg | Intron 2 | insertion of 1039 bp |
85062 | 85081 | tttccttcagttctattttt | Intron 2 | insertion of 407 bp |
86294 | 86313 | tctttctaagttatttattt | Exon 3, 3'-UTR | deletion of 825 bp |
86384 | 86403 | ttttattcagcacaccacat | Exon 3, 3'-UTR | deletion of 915 bp |
NetGene2 v. 2.4 | ||||
Acceptor site predictions: | ||||
position 5'-> 3' | Sequence (5'-> 3') | Function | ||
80140 | TATGTTTTAG*GCATCCTGGA | Exon 2 acceptor | ||
85478 | TCCTTTGCAG *AAAGAATTTA | Exon 2 acceptor | ||
Alternative acceptor sites: | ||||
position 5'-> 3' | Sequence (5'-> 3') | Localization | Effect on FGF10 transcript | |
82618 | CTCCCAATAG*ATTGTGACCT | Intron 2 | insertion of 2860 bp | |
86393 | TTTTATTCAG*CACACCACAT | Exon 3, 3'-UTR | deletion of 915 bp | |