Skip to main content

Table 5 Pyrosequencing primers, dispensation order and sequence to analyse for relevant assays

From: Resequencing of genes for transforming growth factor β1 (TGFB1) type 1 and 2 receptors (TGFBR1, TGFBR2), and association analysis of variants with diabetic nephropathy

Primer Set Forward Primer Reverse Primer Sequence Primer Dispensation order Sequence to Analyse
TGFBR2 c.*747C>G tcctgtgtgcccttatttctc tgaaggtaaaaagtggggttc agtttctaaactaggttgag tcgagagtctac c/ggagagtttctaaac
TGFBR2 c.1149G>A gatcacactccatgtggg ccagacgcagggaaagc agagctccaatatcctc tgatgagacgac tac g/atgaagaacgacctaacc