Skip to main content

Table 4 TaqMan primers, probes, quencher and annealing temperature for relevant assays.

From: Resequencing of genes for transforming growth factor β1 (TGFB1) type 1 and 2 receptors (TGFBR1, TGFBR2), and association analysis of variants with diabetic nephropathy

Primer set Primer 1 Primer 2 FAM™ Labelled Probe Vic™ Labelled Probe Fluorescent Quencher Anneal (1 minute)
TGFB1 -800G>A gctatcgcctgcacacagc aggacagaagcggtcccat tgcctccaacgtcaccaccatc tctgcctccaacatcaccaccatc TAMRA 62°C
TGFB1 -509C>T ttagccacatgggaggtgct ccaggcggagaaggcttaa acccttccatccctcaggtgtcct ccctcccatccttcaggtgtcctg TAMRA 62°C
TGFB1 +869T>C caccacaccagccctgttc ccaggcgtcagcaccagta agcagcggcagca cagcagcagcagc None 60°C
TGFB1 +915G>C Developed by Applied Biosystems (USA) as a Research and Development Kit None 56°C
  1. TGFBR1+72InsC was genotyped by a commercial Invader kit designed and manufactured by Third WAVE technologies (Madison, MI, USA)