Skip to main content

Table 2 Primer sequences used for screening TGFBR1 and TGFBR2 genes

From: Resequencing of genes for transforming growth factor β1 (TGFB1) type 1 and 2 receptors (TGFBR1, TGFBR2), and association analysis of variants with diabetic nephropathy

Primer Set Primer 1 Primer 2
TGFBR1 i tcctccttaaaaggttctgc agaaagtcctcagatcccag
TGFBR1 ii ggaggctatttgggggtgt gcgagcgccggtttctg
TGFBR1 iii actcacacagacacaccca aagagcaggagcgagccag
TGFBR1 iv ctaagagcaacaaacagtgc gtcacttcttgcctctaaacg
TGFBR1 v tgcaggaattgtgtaggattg tggagctgacttattgattcg
TGFBR1 vi ctccccagtgagataaattc aatcttgaagaagttcctag
TGFBR1 vii gcttactctgaggaactaaag agatgcggttttgtcatgttg
TGFBR1 viii aagtattgtaggtcatgtgg gatattttctggaagggcaac
TGFBR1 ix gtctgaaaggaggttcatc caggaagagaatacactagg
TGFBR1 x gtgatcttttaatgccttgg aacattggtttgactgcta
TGFBR1 xi caccagtaccctattgatgg aaggagagttcaggcaaagc
TGFBR1 xii gcaactcagtcaacaggaag gaatcaaggaaactctagtgg
TGFBR1 xiii agaaagtgatttactcct g attcaaacatgaccatgc
TGFBR1 xiv ctttctcctaccaaaatgtgc ctgaattaaaagctgccttcc
TGFBR2 i cctcctggctggcgagcg ggaccaaacgtgccccgc
TGFBR2 ii aagcaaatggctactcaacc acacatacatgcagagaacacc
TGFBR2 iii tgcgaatgctggagaacagg ggaggacaccacctaacgtatg
TGFBR2 iv agctgaagtttgaaggaagagc gcacacggttgttgtagttggt
TGFBR2 v catcatcttctactgctaccgc ggttcccgttggatgtcctcat
TGFBR2 vi ggagttggggaaacaatactgg gggtcaagtcgtgtaaaaaagg
TGFBR2 vii ctatctgtacctttctgtgc ccaatacgatttgtcggatc
TGFBR2 viii gttacttagtgcttcatgctcc ccttccagggtaacacaagata
TGFBR2 ix gtgttgggagtgttagtgtacc ccgtaggtctaccacacactct
TGFBR2 x accaactcatggtgccctttgg cggtatggaacttttctctg
TGFBR2 xi gctgtgttagcacttcctcagg ggtttagaccccccgatcaaat
TGFBR2 xii tgtttgaggaccagtgttcccg ccgaggactaacgagttcgtgt